Neurons and mature red blood cells do not divide. Skin cells and stomach cells grow and divide rapidly and regularly.
Neurons are cells of the nervous system that do not have centrioles because the centriole is an important organelle for cell division.
Red blood cells do not have nuclei or other organelles required for DNA and RNA synthesis. So they can't divide.
Skin cells lose dead cells every day. So they divide rapidly and regularly to replace the lost cells to prevent infection.
The cells lining the stomach undergo wear and tear during food absorption, digestion, and waste elimination. So these cells also divide rapidly and regularly to replace the lost cells.
To know more about cell division:
https://brainly.com/question/13312481
As a result of an action potential, AcH is released from the axon terminal and attaches to receptors on the motor end plate. Sodium rushes in the T-tubules and all the steps occur until the muscle contracts in the leg and carry out the command transported by the motor neuron. Which gray horn is the cell body of the motor neuron located? Infer and explain if this is a positive or negative feedback
Acetylcholine (ACh), a chemical transmitter, is released into the synaptic cleft. ACh diffuses through the postsynaptic or post junctional membrane and binds to specific receptors there.
What is chemical transmitter?Chemical transmitter is defined as a signaling substance that a neuron secretes in order to influence another cell across a synapse. Typically, a transmitter transforms the sensor's output into a signal level fit for a controller's input.
Exercise causes the skeletal muscles to contract and alter. Acetylcholine, a neurotransmitter, is produced from nerve endings and binds to receptors called AChRs on the surface of muscles in (A). Sodium channels activate as a result of the subsequent depolarization, triggering an action potential that travels throughout the cell.
Thus, Acetylcholine (ACh), a chemical transmitter, is released into the synaptic cleft. ACh diffuses through the postsynaptic or post junctional membrane and binds to specific receptors there.
To learn more about chemical transmitter, refer to the link below:
https://brainly.com/question/2084370
#SPJ1
Using the following genomic sequence:
1) Underline each intron
2) Circle each exon
UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG
AUAAUGUUUUUACCCACCAACGACGCCAUGUGACGUCGAAUGACUACCAAUGCU
GCUGGACUAACAUAAUCGUAUGGAAGGGUGUCAAUGUUCUCCUAUGUAAUGUAA
CAUAAU
Intron are underlined and the Exon circled (in brackets)
(UUU)(AUG)(ACU)(AAU)(GAU)(GAA)UAA(UAU)(AUG)(AUG)(CGU)(AGU)(AAU)(CCU)(UCU)(GCA)(GAU)UAG
(AUA)(AUG)(UUU)(UUA)(CCC)(ACC)(AAC)(GAC)(GCC)(AUG)UGA(CGU)(CGA)(AUG)(ACU)(ACC)(AAU)(GCU)
(GCU)(GGA)(CUA)(ACA)UAA(UCG)(UAU)(GGA)(AGG)(GUG)(UCA)(AUG)(UUC)(UCC)(UAU)(GUA)(AUG)UAA
(CAU)(AAU)
What is genomic sequencing?The method used in the laboratory for determining the genetic make up of any organism or their cell type is called genomic sequencing. Genes are made up of introns and exons which are nucleotide sequences.
Introns are none coding sections of heterogeneous nuclear RNA and are removed by splicing as the RNA matures while exons are present in messenger RNA that encodes the amino acids of protein. Genes have various exons that bear introns linking them.
Learn more on genomic sequence here: https://brainly.com/question/29316113
#SPJ1
How has the flow of carbon changed between the atmosphere and plants?
Answer:
Plants on land have taken up approximately 25 percent of the carbon dioxide that humans have put into the atmosphere. The amount of carbon that plants take up varies greatly from year to year, but in general, the world's plants have increased the amount of carbon dioxide they absorb since 1960
Explanation:
For example, in the food chain, plants move carbon from the atmosphere into the biosphere through photosynthesis. They use energy from the sun to chemically combine carbon dioxide with hydrogen and oxygen from water to create sugar molecules.
I just searched up Hope it helps!
If the female is a carrier for the x-linked trait for colorblindness, and the male is colorblind, what percentage of their daughters wilI be colorblind?
Answer: 50%
Explanation: I used Punnet squares and past answers.
considering I used past answers it has to be correct. (the past answers were from less than a week ago)
The circulatory system delivers hormones released by the ______________________ system to the body.
The person who gets it correct get brainly
the process of oxygen depletion due to nutrients such as nitrogen and phosphorous entering marine systems and causing algal blooms is called _______.
Answer:
the process of oxygen depletion due to nutrients such as nitrogen and phosphorous entering marine systems and causing algal blooms is called Eutrophication
Eutrophication is the oxygen depletion process that occurs due to nutrients such as nitrogen and phosphorus in the marine system resulting in algal blooms.
Eutrophication is a main problem in the aquatic ecosystem. It occurs when the lake or estuaries are rich in nutrients like nitrogen and phosphorus.
The deposition of these nutrients in water bodies occurs because of the surface runoff of agricultural lands.
These nutrients are required by microorganisms, phytoplankton, and algae for their growth. So they consume these nutrients and grow enormously and cover the lake as a green meadow or algal bloom.
So the sunlight or oxygen can't reach underwater. As a result, the aquatic organisms begin to die.
To know more about algal bloom:
https://brainly.com/question/17021907
A
B
Which type of bacteria
stain purple during Gram
staining?
Gram-negative bacteria
Gram-positive bacteria this
Answer:
b) Gram-positive bacteria
Explanation:
Gram-positive bacteria stain purple during Gram staining. Gram-negative bacteria turns into red (or) pink. Therefore, the option (b) is the correct answer.
5. A man with group A blood marries a woman with group B blood. Their child has
group O blood. What are the genotypes of these individuals? What other
genotypes and in what frequencies, would you expect in offspring from this
marriage.
If a child with blood group O is born to the parents with blood group A of father and B of mother, then their genotype will be [tex]I^{A} I^{i}[/tex] and [tex]I^{B} I^{i}[/tex] respectively.
Blood group is the type antibodies and antigens present in the blood of the individual. These antibodies and antigens are heritable and transferred from the parent to the child in the form of genes. There are 4 types of blood groups. These are: A, B, AB and O.
Genotype is the genetic composition of an individual. It can off the whole genome or for a single trait. When the genotype [tex]I^{A} I^{i}[/tex] and [tex]I^{B} I^{i}[/tex] are crossed they have the potential to give birth to a child with genotype [tex]I^{i} I^{i}[/tex], and this justifies the birth of child with blood group O.
To know more about genotype, here
brainly.com/question/410918
#SPJ1
How does a cell know when to divide, when to duplicate its chromosomes, or when to enter another stage of the cell cycle.
A cell knows when to divide when to duplicate its chromosomes, or when to enter another stage of the cell cycle by communicating with each other using chemical signals from special proteins called cyclins.
Cells control their division by exchanging chemical signals via unique proteins called cyclins with one another. These signals function as switches that inform cells when to begin dividing and then when to stop.
A cell has to go through a number of checkpoints in order to transition from one stage of its life cycle to the next. Specialized proteins inspect each checkpoint to see if the required circumstances are there. If so, the cell can move on to the following stage.
In order for each new cell to include all of the necessary genetic information, the genes must also produce copies of themselves prior to cell division.
To learn more about Cell visit: https://brainly.com/question/1303025
#SPJ1
what is a good answer to ape theory
Which of these examples involves a human body organ creating a force?
A The skin produces sweat on a hot day to help cool the body off.
B
C
The brain sending electrical impulses
The stomach releasing gastric acid to help break down food
D The heart pumping blood through the veins
Answer:
D
Explanation:
The heart is a muscle that physical contracts to force blood through the human body. I'm around 90% it is D.
Select all the correct answers.
The image shows a rain forest ecosystem. The energy from plants, or producers, acts as the starting point of energy in the ecosystem. This energy is transferred to other organisms in the food web. In which two ways is the total amount of energy conserved in the ecosystem?
The organisms get some energy, while the remaining energy is discharged as thermal energy into the ecosystem. In an ecosystem, as we proceed up the trophic levels, we notice that the amount of energy keeps decreasing.
This phenomenon happens as a result of an ecosystem's inefficient energy transfer from one trophic level to another. The majority of the energy is discharged into the atmosphere as heat. It is known that around 10% of the energy in an ecosystem moves from one trophic level to another.
Thus, we can state that while the organisms receive some energy, the remainder enters the ecosystem as thermal energy. The amount of energy in an ecosystem decreases as we move up the trophic levels, as can be seen.
LEARN MORE ABOUT THE ECOSYSTEM HERE:
https://brainly.com/question/13979184
#SPJ1
Your question is incomplete. Please find the complete question below.
Question: The image shows a rainforest ecosystem. The energy from plants, or producers, acts as the starting point of energy in the ecosystem. This energy is transferred to other organisms in the food web. In which two ways is the total amount of energy conserved in the ecosystem?
A. Some energy is transferred to the organisms, and the remaining energy is released into the ecosystem as thermal energy.
B. Bacteria eat the dead bodies of organisms to release the organisms’ stored energy into the atmosphere.
C. Some energy is transferred to the smaller organisms, and the rest is stored in the bodies of larger animals.
D. Some energy is transferred to the organisms, and the rest is released by plants in the form of carbon dioxide.
E. Bacteria eat the dead bodies of organisms, obtain all the energy, and store it in their bodies.
Unlike perennials, annuals
A. must be grown in handing baskets
B. Cannot be grown in the sun
C. Need plenty of shade
D. Finish their life cycles in a year
Explain what are two factors that determine the thermal energy of a substance
The factors that determine the thermal energy of a substance are temperature and mass, which are associated to the number of particles (mass) and kinetic energy (temperature).
What is thermal energy?The term thermal energy makes reference to a type of kinetic energy in which the particles are in constant movement, in the opposite way than potential energy which makes reference to the storage of energy such as occurs in the chemical bonds of foods.
This type of energy (thermal energy) is associated with the relative movement of particles in a substance, i.e. its temperature, as well as the mass which depends on the number of particles that form the substance.
Therefore, with this data, we can see that thermal energy depends on both the temperature or relative movement of particles and also the mass of a given object, which is represented by the number of particles per unit of area.
Learn more about thermal energy here:
https://brainly.com/question/19666326
#SPJ1
7. Which landform is the result of glacial erosion?
A. a horn
B. a moraine
C. an outwash plain
Answer:
i believe its A.horn
Explanation:
hope this helps ya;)
Describe how you could make up the following glucose concentrations when given a 1% standard solution(there may be several different ways for each) A)0.02%. B)0.003%. C)0.0005%
0.02%. glucose concentrations when a 1% standard solution is administered.
How is 1% glucose solution made?By multiplying (mass/volume) by volume and keeping in mind that 1 g in 100 ml equals a 1 percent solution, you can determine how much glucose is required to form a solution of a certain percent. For this example, multiply (20/100) by 500 to create a total solution of 500 ml of 20 percent glucose.
What is 1% of a concentration?A 1% (w/w) concentration is created by combining 1 g of one substance with 100 g of another, such as 1% (w/w) salt in sand. Another vintage signifier of concentration that you could still come across (simply take a look at the side of the term "parts per million (ppm)" is used.
To know more about glucose concentrations visit:-
https://brainly.com/question/3499336
#SPJ1
Select all that apply.
Proteins____
A. contain carbon, hydrogen, oxygen, and nitrogen.
B. consist of amino acids
C. are derived from fruits and vegetables
D. are part of antibodies
Answer: the answer is option are option B and C.
Explanation: Proteins are made up of bulk units of amino acids progressively in our body, which are connected to each other as one long chain.
there are 20 different amino acids that compose the proteins, they can be derived from fruits and vegetables.
to know more about proteins,
brainly.com/question/28870428
A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER). Which of the following functions is this cell type most likely specialized to perform?
A. The production and secretion of steroids
B. The destruction of toxic materials produced in other cells of the organism
C. The synthesis of polysaccharides for energy storage
D. The production and secretion of proteins
A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER). Which of the following functions is this cell type most likely specialized to perform?
A. The production and secretion of steroids
B. The destruction of toxic materials produced in other cells of the organism
C. The synthesis of polysaccharides for energy storage
D. The production and secretion of proteins
Hope this helps :)
PLEASE, PLEASE, PLEASEE!!!
EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY
The following lists components of the nature of science. Explain how at least two of these are related to the cell theory:
Scientific knowledge is durable yet subject to change
Science is a social activity.
x
Science is the process by which knowledge is created. Despite the fact that scientists reject the idea of discovering perfect truth and accept some uncertainty as a part of nature, the majority of scientific knowledge is enduring.
Cell theory is a biological theory first proposed in the mid-nineteenth century that states that living organisms are made up of cells, that cells are the basic structural/organizational unit of all organisms, and that all cells originate from pre-existing cells. The following are the basic tenets of cell theory: Every living thing is composed of one or more cells. All living things are made up of cells, which are structural and functional units. Cells are formed by the division of pre-existing cells. In terms of chemical composition, all cells are the same.
Theodor Schwann proposed the classical cell theory in 1839. This theory is divided into three parts. The first section asserts that all organisms are made up of cells. Other living cells produce all existing cells. Other living cells produce all existing cells. The cell is the most fundamental unit of life.
To learn more about cell theory, here
https://brainly.com/question/1468725
#SPJ1
Which of the following statements about mutations is false?
a. Addition and deletion mutations disrupt the primary structure of proteins.
b. An addition mutation results in an added base in the DNA sequence.
c. A deletion mutation results in the loss of a base in the DNA sequence.
d. A knock-out mutation results in a total absence of the mutated protein.
The false statement about mutations is: A knock-out mutation results in a total absence of the mutated protein.
Altering the genome's nucleic acid sequence of an organism, virus, or extrachromosomal DNA is known as a mutation.
Knock-out mutation refers to a DNA change that completely halts a gene's expression. In all types of cells and creatures, this is achievable using certain genetic techniques. CRISPR genome editing is currently the quickest and most direct method for accomplishing precise gene knockdown.
To learn more about Knock-out mutation click here,
https://brainly.com/question/29361996
#SPJ4
In addition to seeds, which of the following characteristics is unique to the seed-producing plants?
A) sporopollenin
B) lignin present in cell walls
C) pollen
D) use of air currents as a dispersal agent
E) megaphylls
All organisms use respiration, but?
Which of the following is
TRUE about viruses?
A. Viruses CANNOT be cured by
antibiotics. This
B. Viruses are easily cured by
antibiotics.
C. All viruses can be cured by
antibiotics.
D. Many viruses are able to be cured
with antibiotics.
Answer:
A. Viruses CANNOT be cured by
antibiotics
Explanation:
Answer:
a) Viruses cannot be cured by antibiotics.
Explanation:
"Viruses cannot be cured by antibiotics" is true about viruses. Because, the antibiotics can only cure bacterial diseases. Hence, the option (a) is the correct answer.
4. This fossil pterodactyl and this living elephant both have a bone in their hip called the ilium. What best explains why both species have an ilium?
Answer:
Explanation:
The pterodactyl and elephant both share the same ancestor population that had an ilium bone. They inherited this structure from the ancestor population. I hope this helps!
please help thanks
write an equation that represents the difference in seed yield between beans without treatment and beans with treatment
The equation (seed yield with treatments and seed yield without treatments) has a value of 340 and represents the difference in seed yield between beans with and without treatments.
microorganisms that fix nitrogen, indicating a novel way to increase yields, communicate with soybean roots. Soybean plants collaborate with a bacterium known as rhizobia, which can transform atmospheric nitrogen into organic forms the plant can use to receive the nitrogen they require.
The details which are available to us are the diagram that shows the seed yield.
The necessary equation to express the variation in seed yield between beans treated and untreated is as follows:
(Seed yield following treatment vs. seed yield in the absence of treatment)
[tex](300+310-270)= (610-270)= 340[/tex]
Therefore, the equation (seed yield with treatments-seed yield without treatments) will have a value of 340 and shows the difference in seed yield between beans with and without medicines.
LEARN MORE ABOUT NITROGEN-FIXING BACTERIA HERE:
https://brainly.com/question/7049583
#SPJ1
What is cystic fibrosis at least five 5 conceptos
Answer: There are five concepts of cystic fibrosis. They have
People with CF can't be together.CF and Tay Sachs are tied to fatal Jewish genetic diseases.Our skin is super salty.We are master deceptors.The nickname for CF is 65 roses.Explanation:
1. People with CF can't be together.
The thick, sticky mucus that builds up in our lungs functions like silly puddy. So, when bacteria enter our lungs, they tend to stick around forever whereas healthy people’s immune systems can fight them away. As a result, people with CF harbor dangerous bacteria in their lungs, which are contagious only to other people with CF or compromised immune systems.
The excellent news is CF is not at all contagious or dangerous to healthy people. The bad news is the cross-infection risks mean people with CF are advised not to be within 6 feet of one another.
In response, we’ve formed thriving online communities so that we can benefit from information sharing and support, but there’s no denying that virtual connections can never replace in-person ones. For me, this is one of the hardest things about CF.
2. CF and Tay Sachs are tied as fatal Jewish genetic diseases.
When you think of fatal Jewish genetic disease, you think “Tay Sachs,” right? But the truth is that approximately one in 25 to 27 Ashkenazi Jews is a carrier of CF, making it just as prevalent as Tay Sachs. That’s why Emily’s Entourage is on a mission to get the word out to the Jewish community that CF is their disease, too.
3. Our skin is super salty.
Back in the day, salty skin was the hallmark characteristic of CF. The reason is that a faulty salt chloride channel causes people with CF to excrete too much salt. In other words, when we sweat, we lose too much salt, which puts us at an increased risk of dehydration.
If it’s hot outside and you lick the skin of someone with CF (with permission, of course!), you’ll taste how salty they are! You may even see salt crystalize on their skin.
To this day, the diagnostic test for CF is called a “sweat test” because it measures the salt chloride levels in your sweat.
4. We are master deceptors.
CF is an invisible disease, which means that, as sick as our lungs and other organs are on the inside, you can’t tell from the outside. Just from looking at me, you’d probably never guess that I have less than a third of the average lung function or that I’m teetering on the brink of lung transplant evaluation.
This is a blessing and a curse. The downside is that it is often hard to appreciate how sick we feel and how difficult everyday tasks are because we look so deceivingly healthy on the outside. But on the flip side, it’s nice not to wear our disease on our sleeve, so to speak, so people see more than just our disease when they look at us. Plus, looking healthy rather than sickly is generally a good thing.
5. The nickname for CF is 65 roses.
Way back when children with CF had trouble pronouncing “Cystic Fibrosis.” So, they came up with a nickname with a similar ring: sixty-five roses. Roses certainly evoke a much lovely image than a life-threatening disease. In fact, the nickname stuck so much that it is still used today and roses have become an unofficial symbol of CF.
Which is the odd one out - ant, ostrich, prawn, snake, turtle
Answer:
Ostrich
Explanation:
Ant, prawn, snake and turtle are all poikilothermic (or cold-blooded) whereas ostrich is an endotherm (or warm-blooded) making it the odd one out.
The options given are cold blooded animals along with one odd option. The correct answer is ostrich.
What is the class of ostrich ?
Ostrich is the largest bird. It lays largest eggs and the ostrich are the birds that can not fly as they are very heavy in weight. It belongs to the class aves.
Ostrich is a bird that is poikilothermic in nature. Birds are poikilothermic that is warm blooded. Birds have the warm blood and these are able to maintain their warm temperature, these are ectothermic in nature. In case of reptiles and insects where the class reptilia and the class insecta are the species to which the remaining belong to.
The only different is that the ostrich is poikilothermic in nature that is it is warm blooded in nature. The other reptiles and insects are cold blooded that is endothermic in nature.
Learn more about poikilotherms at :
https://brainly.com/question/18566936
#SPJ2
Similar to the Galápagos finches, the Hawalian honeycreepers are a group of diverse
birds that are descended from a common ancestor. Over time, different adaptations
evolved for feeding and mating in their respective habitats. V Compare How does
common ancestry explain Loss's observations of anoles?
According to DNA sequencing data, lizards on each island are more closely related to one another than to similar species on other islands, implying that the same types of anoles evolved independently on different islands.
Divergent evolution refers to the process by which different organisms with common ancestors develop different traits or characteristics in order to adapt to changing environmental conditions and needs. It is also referred to as adaptive radiation. The Galapagos finch is a classic example of divergent evolution, as Darwin discovered that the finches' beaks adapted differently in different environments.
Convergent evolution occurs when species occupy similar ecological niches and respond to similar selective pressures in similar ways. Analogous structures are traits that emerge as a result of convergent evolution. They are distinguished from 'homologous structures,' which share a common origin. This is because anoles are a spectacular example of convergent evolution, in which different living things independently acquire the same adaptations to the same challenges.
To learn more about divergent and convergent evolution, here
https://brainly.com/question/3405872
#SPJ1
What happens in the energy harvesting phase of glycolysis?
O Glucose is transformed into fructose diphosphate.
O Fructose diphosphate splits into two 3-carbon molecules.
O ATP molecules are broken down to ADP and a phosphate group.
O Glyceraldehyde 3-phosphate is converted into pyruvate.
The energy payoff phase of glycolysis consists of five additional steps and results in the formation of four ATP, two NADH + H+, and two pyruvate molecules. Substrate level phosphorylation is the process by which ATP is produced from the transfer of a phosphate group from a substrate molecule in a metabolic pathway.
Through a sequence of processes known as glycolysis, glucose is divided into two pyruvate molecules, each of which has three carbons. The vast majority of creatures on the planet today use glycolysis, which is an old metabolic route that originated long ago. 2,3 2,3 start superscript, 2, comma, 3, end superscript
Glycolysis is the initial step in the process of cellular respiration in organisms. However, many anaerobic organisms—organisms that do not use oxygen—also contain this route since glycolysis does not require oxygen.
To know more about glycolysis visit:
https://brainly.com/question/14076989
#SPJ9
what is the location of most of the organelles and where most of the cell processes take place?
The Cytoplasm is the location of the most organelles where most cell processes take place.
Answer:
the cytoplasm
Explanation: