In the laboratory, yeast cells are usually grown at a temperature of 25oC. A scientist wanted to determine if yeast cells would reproduce faster or slower when the temperature was dropped to 15oC. The same number of yeast cells were placed in the same medium with the same amount of nutrients. One sample was kept at 25oC and the other one was kept at 15oC. The number of yeast cells was counted every hour for an eighteen hour period.

Answers

Answer 1

Answer:

This question is incomplete, however, it is asking to identify the following variables:

Independent variable: Temperature

Dependent variable: Number of yeast cells

Constants: same amount of nutrients, same number of yeast cells, same medium

Explanation:

- Independent variable is the variable that the experimenter changes or manipulates in order to bring about a measurable effect. In this experiment, the TEMPERATURE at which the yeast are kept is the independent variable.

- Dependent variable is the variable that responds to the changes made to the independent variable. It is the variable that is measured by the experimenter in the experiment. In this case, The NUMBER OF YEAST CELLS was counted, hence, it is the dependent variable.

- Constants are variables that are kept unchanged or same for all groups by the experimenter in order not to influence the experiment's outcome. In this case, the CONSTANTS are: same amount of nutrients, same number of yeast cells, same medium etc.


Related Questions

helppp hah im stuck with this

Answers

It won’t show the picture

Answer:

oh

Explanation:

PLS HELP ME IM STRESSING RIGHT NOW I JUST NEED HELP ON THIS

Which statement accurately describes a mountain ecosystem?
They usually host three or more ecosystems where animals can’t live.
They usually host one ecosystem with a variety of wildlife.
They usually host one ecosystem with a variety of plants.
They host three or more distinct ecosystems.

Answers

Mountain life has many life and plants, so it’s not A, it could be b or c but D makes most sense I don’t know what 3 or more distinct ecosystems mean though

How do I fly? :(;):)

Answers

Answer:

Hm

Explanation:

Try a few things like an airplane, jetpack, etc

By flying and flying and Flying some more

The conditions for an enzyme to work need to be?

Answers

They need to be capable of making proteins in that area


What cellular structure begins to reform during telophase?

Answers

Answer:

nuclear membrane

Explanation:

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

7 Which answer best describes
condensation?
A A gas changing into a liquid
B A liquid changing into a solid
C A solid changing into a liquid
D A liquid changing into a gas

Answers

A is the correct answer.
The answer is: A gas changing into a liquid

A primary air pollutant is put directly into air by human activity.What is a secondary air pollutant

Answers

Answer:

Acid Rain

Explanation:

Acid rain, which is made up of several acidic compounds, forms when sulfur dioxide and nitrogen dioxide react in the air with water, oxygen and other chemicals. On the ground, acid rain damages plants and trees and increases the acidity levels of soils and bodies of water, causing damage to ecosystems. Acid rain also causes decay to buildings and can irritate the eyes and airways.

Plants receive carbon dioxide through their ____________.

Answers

Answer:

leaves,stomata

Explanation:

The carbon dioxide enters the leaves of the plant through the stomata present on their surface.

Answer:

Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots.

Explanation:

why does the cell get longer during anaphase

Answers

Answer:chromosomes are separated by a structure called the mitotic spindle and then pulled by the spindle to opposite poles of the cell

Explanation:

2.3/6.E.2.4 Test 1 2 of 30
Which element causes soil to appear red?
O A. calcium
B. iron
c. magnesium
D. silicon

Answers

Answer:

B

because iron appears the color red

Organisms are composed of many complex molecules. These molecules are composed mainly of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Which of the following statements most accurately describes how these molecules are made in ALL organisms?​

Answers

Its oxygen because all living organisms need oxygen to survive

Make a food web for the rainforest

Answers

Answer:

VEGETERIANS, VEGANS, CARNIVORES, CANNIBALS, Omnivores

Explanation: EVERYWHERE!!

William wanted to create a report on a geographical location with the greatest species diversity. Which ecosystem can he consider for his report?

Answers

Answer:

Forest ecosystem or marine ecosystem.

Explanation:

Forest ecosystem is considered for his report because large number of organisms are present in forest ecosystem. Species diversity is greatest in the geographical location of tropics, particularly in tropical forests. Marine ecosystem is also considered for his report due to the presence of large number of different types of species particularly in coral reef which is a habitat of large number of organism.

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

PLEASE HELP
Which process does this picture show?*

Transcription
Translation
Replication
Transformation

Answers

transformation i think iono lol

A new drug is discovered for the treatment of thyroid cancer. Which is a logical next step of the scientific method after the discovery has been successfully tested?


keeping the information private

testing the drug on animals

sharing the data with other scientists

testing the drug on people

Answers

Answer:

The answer would probably be either c or d

Help (will give crown for answer)

Answers

Answer:genes

Explanation:

Does all human activity have a negative impact on the environment and
ecosystems? *
A:NO
B:YES

Please help for my homework

Answers

Answer:

No

Explanation:

Answer:

A. NO

Explanation:

Because it depends if the activity. negatively or positively. Because humans can be very careful of how they affect the Earth and sometimes they can't.

What is the probability of getting a short pea plant when crossing the parents Tt with tt?

Answers

Answer:

50%

Explanation:

One half of the punnet square would be Tt and the other half would be tt.

Fossils usually occur in metamorphic rock. true or false?​

Answers

Answer:

false

Explanation:

They can't survive the great pressures metamorphic rocks go through. They usually are only in sedimentary rocks. Hope this helps!

Answer:

false

Explanation:

Fossils are very fragile and metamorphic rocks go through some harsh changes, so i'd be impossible for fossils to stay intact or even form in metamorphic rocks

Based on an analysis of the data, describe the effect of karrikins on seed
germination in the autotrophic host plants and the obligate parasitic weed plants.

Answers

Answer:

It triggers seed germination by activating hormone.

Explanation:

Karrikins has a great effect on seed  germination in the plants as well as the obligate parasitic weed plants because it trigger the germination of seed by signaling of hormone known as strigolactone which is responsible for the germination of see. Karrikins are the group of plant growth regulators which is present in the smoke of burning plant.

What are the DNA strands called?
What is the RNA stand called?

Answers

Answer:

it rna means

Ribonucleic acid

Answer:

DNA strands - polynucleotides

RNA strand - nucleotide chain

Explanation:

DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.

RNA is composed of a single nucleotide chain.

Hope this helps :)

What is the role of the nucleus in plant and animal cells?
O
A. It stores the genetic information for the cell.
B. It serves as a boundary for the cell.
o
C. It produces energy for the cell.
O
D. It stores waste for the cell.

Answers

Answer:

Explanation:

It’s A I’m pretty sure

Why is cellular differentiation
important for the development of a fully formed human infant?

Answers

Answer:

Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant. Without tissues and organs our body cannot function properly.

Answer:

Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant.

:

The least amount of vertical change during the monthly tidal cycle occurs
a. At the beginning of the month
b. At the end of the month
c. at the quarter moons
d. at the full moon​

Answers

It’s d because if you think about it the monthly tidal cycle is a full moon and you will see that on a full moon does that make sense? Lol

A environmental scientist buys 20 gallons of oil eating bacteria to help remediate an area affected by an oil spill. The volume of water the scientist wants to cover with this bacteria is 5 ft³. What volume of water can the scientist cover with the bacteria she purchased? (1 gal = 0.13 ft³)

Answers

Answer:

2.6  [tex]ft^3[/tex]

Explanation:

Using the conversion factor:

1 gallon = 0.13 [tex]ft^3[/tex]

Therefore,

20 gallons = 20 x 0.13

       = 2.6‬  [tex]ft^3[/tex]

This means that only 2.6  [tex]ft^3[/tex] out of the 5  [tex]ft^3[/tex] total volume of water the scientist wants to cover can actually be covered by the bacteria that was purchased.  

____ can be used for different types of surgery.
a. Lenses
b. Lasers
c. Diffractions
d. Refractions
(Lasers)

Answers

Answer:

lenses can be used for diffrent types of surgery

Plz help I’ll mark brainliest

Answers

Answer:

I'm pretty sure it's exponential growth.

Explanation:

Answer:

expontential growth!!

Explanation:

What type of muscle has a primary purpose of animal movement?

A) cardiac muscle
B) smooth muscle
C) tendons
D) skeletal muscle

Answers

Answer:

B. Smooth Muscle

Explanation:

Medusae are among the simplest animals that use muscles to make rhythmic movements. In at least some medusae, the circular muscles, which do most of the work of swimming, are striated. In contrast, most of the other muscles of cnidarians are smooth.

Answer:

D) skeletal muscle

Explanation:

skeletal muscle cells join together to form fascicles, and fascicles form the skeletal muscle.

Other Questions
help Math 39 points Asap Probability image below Which of the following is NOT a structure that is similar in the embryological development of humans, fish, lizards, and birdsGillsTailSpinal cordsFeathers why do you think these decisions are called landmark decisions? Please help me... find the area of this shape PLEASE HELP WILL MARK BRAINLY 1. Jacob has $500 saved. He receives a gift of $100 as a graduation present.Write an expression for the total amount of money he has. In silkworms,yellow cocoon (B) is dominat over white cocoon(b). If the mom is BB and the dad is bb, what are the chances they have offspring with yellow cocoons? List three things Anson Jones did as president of Texas. (OC1) !!HELP ASAP!! GIVING 15 POINTS!! Read the passage below from The True Confessions of Charlotte Doyle and answer the question.And though I have kept the name, I am notfor reasons you will soon discoverthe same Charlotte Doyle.Excerpts from The True Confessions of Charlotte Doyle, copyright 1990 by Avi. Used by permission of Brandt and Hochman Literary Agents, Inc. All rights reserved.Which of the following themes does the passage suggest?lovetransformationadventureobedience Select all correct answers. Technology helps:A) make things coolerB) make Things easierC) make things fasterD) solve Problems A researcher is conducting research on using technology in teaching. The researcher has two groups. The first group receives instruction via a PowerPoint presentation that is online. The second group attends a class and receives instruction from a teacher face to face. The researcher classifies the students based on when they volunteer for the study. The first 50 students who volunteer receive online instruction. The next 50 receive instruction by attending a class with a teacher. The type of instruction the student receives is the: Why did the art of carving totem poles fade during the1800s? Which of the following limited opportunities for freedmen in the South after the Civil War ended?A. Radical ReconstructionB. Lincoln's Ten Percent PlanC.the Black CodesD. the Fourteenth Amendment Each week in the library Mrs. Hoskins features popular books in the display. This week includes 3 mystery books, 4 biographies, 6 sci fi books 2 dystopian society books. Jack randomly choose one book to read .What is the theoretical probability that it is a biography How many 1/8 are in 1 and 1/4WRITE YOUR ANSWER AS A FRACTION NOT A MIXED NUMBER!!PUt correct answer too please help Solving Exponential Functions PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Refer to the Newsela article "The Relationship between Hunger and War."Part AWhat is a goal of the United Nations?The United Nations promises to lead armed attacks on countries that use starvation as a war tactic.The United Nations supports the use of sanctions against countries that are experiencing food insecurity.The United Nations wants to end hunger and food insecurity around the world.The United Nations aims to end reliance on food imports around the world.Question 2Part BWhich evidence from the text best supports the answer in Part A?"A 2018 U.N. report called the situation in Yemen 'the worst human-made disaster in the modern history of the world.'""The U.N. said using starvation in war is a threat to the lives of millions of people.""Nazi Germany had a plan in World War II that could have starved 20 million people or more.""The resolution tells all parties to maintain food stocks, farms, markets and delivery methods." Which of the following shows a reflection of the triangle over the horizontal axis? Read this excerpt from The Riddle of the Rosetta Stone by James Cross Giblin.Champollion spent almost a year and a half in Egypt. On his return home to Paris, he began the huge job of deciphering and organizing all the material he had gathered. Sad to say, he did not live to see the fruits of his labor. On March 4, 1832, while preparing the results of the expedition for publication, he collapsed and died after a series of strokes. He was only forty-one.Based on the excerpt, what was the effect of Champollions visit to Egypt?Champollion died at the age of forty-one.Champollion returned to Paris. Champollion published a book. Champollion gathered more knowledge. Can Someone summarize the article below into two to three paragraphs, 100 points!!! due soon!!!- Authorities are warning of the "substantial" risk that explosives will be among the "tactics" used during protests before and during the Jan. 20 inauguration of President-elect Joe Biden, piling on to the previous memo urging law enforcement to be prepared for armed demonstrations in all 50 state capitols in the coming days, according to a recent report.an FBI bulletin obtained by ABC News described how the use of "devices targeting infrastructure" has increased in the past several months, and law enforcement should be prepared for the potential use of explosives going forward, according to the report."The danger posed to law enforcement officers and the general public from the all [s.i.c] the tactics listed is substantial, " the bulletin states, according to ABC. "If a suspicious item is reasonably believed to contain explosives, an IED, or other hazardous material, DO NOT touch, tamper with, or move the item. Only bomb disposal personnel should handle any suspected devices that are located."A previous internal FBI memo obtained by Fox News warned of plans for armed protests in all of the state capital cities before, during, and after Jan. 20.The FBI told Fox News at the time that Bureau is "supporting our state, local, and federal law enforcement partners with maintaining public safety in the communities we serve.""Our efforts are focused on identifying, investigating, and distributing individuals that are inciting violence and engaging in criminal activity," the FBI said in an emailed statement.