Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

Where does carbon dioxide come from during photosynthesis?

Describe the structure and function of areolar connective tissue.

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Distinguish between dimorphic, polymorphic, and continuously variable traits.

Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

14. The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

What are examples of devices that use electromagnetic waves? Check all that apply.


-FM radios
-microwaves
=TV remote controls

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.
​

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Help help bell help help

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

pls help click the link answer​

water vapor present in air support water cycle
​

All of the following would result in a population increase except

- a high rate of immigration
- a higher death rate than birth rate
- a low rate of emigration
- a low birth rate