Match the following vocabulary with the definitions.

1. Occurring in the presence of oxygen
2. The stage of respiration that occurs in anaerobic condition In animal cells
3. The first step in the chemical breakdown of glucose
4. Occurring in the absence of oxygen
5. The stage of respiration that occurs in anaerobic conditions In less complex organisms

lactic acid fermentation
anaerobic
alcohol fermentation
glycolysis
aerobic

Answers

Answer 1

Answer:

aerobic- 1. Occurring in the presence of oxygen

lactic acid fermentation- 2. The stage of respiration that occurs in anaerobic condition In animal cells

glycolysis- 3. The first step in the chemical breakdown of glucose

anaerobic- 4. Occurring in the absence of oxygen

alcohol fermentation- 5. The stage of respiration that occurs in anaerobic conditions In less complex organisms

Explanation:


Related Questions

Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?

Answers

Answer:

Do a literature search to find natural history information on closely related species.

Explanation:

In the context,  few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.

They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.

Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog

Answers

Answer:

Beatle

Explanation:

Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

What is Food Web?

A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.

A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.

In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.

Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

Learn more about Food Web, here:

https://brainly.com/question/18816028

#SPJ2

The similarity of the structures shown in the picture suggests that the organisms_______

1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly

Answers

1 because they all had traits that had come form somthing

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.

Which statement is true about gene expression? Give brainlist is answer right

Cells become specialized because different cells contain different sets of genes

Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used

A cell becomes specialized by controlling the which proteins are produced from the cell's DNA

Answers

Answer:

I guess All of them

Explanation:

Gene expression has all of these statements as given above in text.

In your own words, can you explain where a hot
spot can be found AND what does it looks like?

Answers

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes

Answers

C asexual reproduction

Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane

Answers

Answer:

moving across both the plasma membrane and the outer membrane

Explanation:

Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.

2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration

Answers

Answer:

A . the formation of male and female sex cell is known as gametogenesis

the answer is a (gametogenesis)


1. Osmosis and diffusion are same phenomena.​

Answers

Answer:

they are not the same thing. Osmosis is only for water molecules. i found this, hope it is useful,'Osmosis happens when molecules move from higher to lower concentrations, but diffusion happens when it is reversed'

Explanation:

Answer:

Explanation:

Not the same

Pls help this is due today

Answers

Answer:

scientific method can help resolve problems logically

Answer:

b. scientific

Explanation:

the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.

hope this helps! lemme know if you need more

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

What is the main function of the central nervous system ? E2020

Answers

Answer:

The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation:

Answer:

Main function-the interpreter of the environment and  control over body movement.

The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..

Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.

B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.

C. Scientists breed cows that give greater amounts of milk than their ancestors.

D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.

E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.

Answers

Answer:

The Answer is C

Explanation:

When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.

Answer:

C. Scientists breed cows that give greater amounts of milk than their ancestors.

Explanation:

The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:


Which features form along all types of plate boundaries?
Hurry up!!

Answers

Explanation:

Ocean ridges features form along all types of plate boundaries.

How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?

Answers

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.

Explanation:

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet

Explanation:

When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of

Answers

This supports the theory or mendal law of evolution bc the chromosomes Are aligned together

Which of the following is a subsystem of an organism?

Answers

You didn’t post all of it

I have no clue and the internet doenst help

Answers

Answer:

Soda

Explanation:

These are some weird questions...

I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.

what is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide

Answers

Nucleotide is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide.

what are the four primary uses or benefits of the nguni breed amongst South African communities?​

Answers

Answer:

Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.

Explanation:

A 9.0 is how many times more powerful than a
4.0 on the Richter scale?

Answers

Answer:

It increases 31.7 times between whole number

values.

Explanation:

"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.


excluded from work

allowed to continue her duties as long as she does not start to feel worse

reported to the health department

restricted from working with food

Answers

Excluded from work because there’s risk of getting someone else sick and I think cross contamination

helpp mee pleaseeee need help

Answers

Answer: it will increase the frequency of the action potential hope this helps

Explanation:

What is anatomy?

Simple answer please!
I'll give brainlist

Answers

Answer:

Anatomy is the study of the bodies of people and other animals

hope this helps

have a good day :)

Explanation:

Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.


Which organism, roadrunner or the owl, competes more for its food?
Support your answer with evidence from the food web.

Answers

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

What do you mean by predators ?

Predators are animals that hunt, kill, and consume other animals (known as prey) for their sustenance. Predation is a common form of interaction between different species in many ecosystems. Predators come in many different forms, such as mammals, birds, fish, insects, and reptiles.

Predators are typically characterized by certain physical and behavioral adaptations that help them hunt and capture prey. For example, many predators have sharp teeth, claws, or beaks that are used to kill and consume their prey. Others may have specialized hunting techniques or strategies that make them highly effective predators.

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

Roadrunners are known to be opportunistic hunters and can feed on a wide range of prey items. They are ground-dwelling birds and use their speed and agility to catch their prey. Roadrunners are also known to eat eggs and young of other birds, including owls.

Owls, on the other hand, are nocturnal predators that are known for their exceptional hearing and vision, which enables them to hunt in low light conditions. They are also skilled hunters and can catch a variety of prey, including rodents, small mammals, and birds.

Therefore, both roadrunners and owls are capable of competing for food, but the level of competition depends on the availability of prey, habitat, and other factors. In general, the competition between these two species is likely to be limited, as roadrunners are diurnal (active during the day) and owls are nocturnal (active at night).

Learn more about  predators click here:

https://brainly.com/question/29779690

#SPJ1

Other Questions
let abc is a right angle triangle at b. if ac=10cm and ab=8cm the what is the lenght of bc is What was one of China's major achievements during the postclassical era?A. Developing gunpowder weaponsB. Founding the religion of Zen Buddhism C. Creating the first metal coinsD. Setting up the first Chinese dynasty In the decimal expansion of the fraction 1/13, what digit is in the 2021st decimal place?please answer correctly (full answers) CAN I GET THE REAL ANSWER I NEED THIS 100% MY MOM IS GOING WHOOP ME TILL I GOT 10 STAINS ON MY BUTT AND LEGS PLEASE HELP Please help me figure out which is the correct answer, i have attached the picture for you to look at. Thanks so much! Jeremy uses 2 feet 3 inches of board for each birdhouse he builds. How many inches of board does he need to make 6 birdhouses? Use a number line to solve? can sombody help me with a this question Chris and Jen decide to go apple picking at a local apple orchard. As the number of apples they pick increases the cost of the apples also increases. The function ff relates the varying cost of Chris and Jen's apples, cc , in terms of the varying number of pounds of apples that Chris and Jen pick, nn , where c=f(n)c=f(n) and ff is defined by f(n)=0.4n+6f(n)=0.4n+6.Evaluate f1(33) Note( this is F^-1)Determine the rule for the function f^-1 After the student closes the cooler, there NOT any inputs or outputs from this system because ________. a. no energy is being transferred into or out of the cooler b. there is no flow of energy across the system boundary c. there is no matter flowing into or out of the system d. all of the above Songs where the song writer did more work then the performer Based on paragraph 3, the reader can conclude that competition among elite runners is - A nonexistentB secretiveC friendlyD intenseI need by 11:00 pm new york time pleaseeeee 1. Ortografa de la palabra. Completa con a ver, haber, a haber.a) Vamos ______, quin ha ido _____ laexposicin del Museo de Len? Find the equation of a vertical line passing through the point B(2,-1) Workplace accidents are categorized in three groups: minor, moderate, and severe. The probability that a given accident is minor is 0.5, that it is moderate is 0.4, and that it is severe is 0.1. Two accidents occur independently in one month. Calculate the probability that neither accident is severe and at most one is moderate. How does mining impact the enviorment Ferric Chemicals, Inc. has fixed costs of $34,000 per month. The highest production volume during the year was in January when 100,000 units were produced, 71,000 units were sold, and total costs of $640,000 were incurred. In June, the company produced only 60,000 units. What was the total cost incurred in June? (Round any intermediate calculations to the nearest cent and your final answer to the nearest dollar.) For which set of numbers is the number 4 a common multiple?AB.C.D.4.8 and 162.4 and 81, 2 and 40 and 4 Andrews Co. can purchase 20,000 units of Part XYZ from a supplier for $18 per part. Andrews' per unit manufacturing costs for 20,000 units is as follows: Cost Per Unit Total Variable manufacturing cost $12 $240,000 Supervisor salary $3 $60,000 Depreciation $1 $20,000 Allocated fixed overhead $7 $140,000 If the part is purchased, the supervisor position will be eliminated. The special equipment has no other use and no salvage value. Total allocated fixed overhead would be unaffected by the decision. The company should ______. Round 72,934 to the nearest hundreds place and enter the value below. According to exponent rules, when we divide the expressions weexponents.