One of the sixth grade classes at Washington School has 12 girls and 10 boys. What is the ratio of boys to total students in the class?

Answers

Answer 1
Answer:


5:12



Hope this helps you
Answer 2
The answer to this one is 5:12

Related Questions

What are 4 equivalent expressions for 6( y - 1 )?

Answers

1. 6y-6
and that’s the only one i know

Answer: (6y-6

Step-by-step explanation:

A city built a new subway system in 2001. This graph shows the daily number of mass transit trips and the daily number of car trips people took in that city through 2007. What does the data show?

A) As the number of mass transit trips increase, so do the number of car trips.
B) The number of mass transit trips first exceeded the number of car trips in 2005.
C) The number of car trips has decreased every year since the subway system was built.
D)According to the data, the number of mass transit trips and the number of car trips do not appear to be related.

Answers

Answer:

b and c are both correct

Step-by-step explanation:

B and C are both correct

Help me please
Xxxxxxxxx

Answers

It the is bbb bbb. Bbbbbbbbbb

Please help giving brainliest

Answers

Answer:

B

Step-by-step explanation:

1/5 = 0.2

1/3 = 0.33

Answer:

B

Step-by-step explanation:

1/5=0.2

1/3=0.33333.........

Complete the following statement about the given rectangular and triangular pyramids:





Answer here: "The pyramid has greater volume by m3.

Answers

Answer: UM

Step-by-step explanation: Do you still need help?

HELPPPPPPPPPPPPPPPP MEEEEEEEE!!!!!!!!!

Answers

1 in 13 or 1/13 because those are the only numbers it gives you and since he only sold one vanilla cone in the last thirteen cones you can only assume that he sells one vanilla every 13

Answer:

the answer is 12 percent

Step-by-step explanation:

Because if you sold one ice cream that is vanilla then 13 of the last ice creams were sold then that means all the other 12 ice creams were a different kind

Please give me the right answer

Answers

The answer would be b:)
C is the correct answer

If the height of the box is 7 inches, the volume of the box will be [1] cubic inches.
A box is shaped like an octagonal prism. Here is what the base of the prism looks like.

Answers

Answer:should be 41

Step-by-step explanation:

this is the picture for the previous question i asked

Answers

Answer:

See below

Step-by-step explanation:

Well, we know the scale is 1 1/2 inches to 4 feet and that one side length of the scaled drawing sqaure is 3 inches, so . . .

3/1 1/2 (3 divided by one and one-half)

to get: 2

Then multiply it by the scale factor of 4

2*4= 8

But remeber, this is only ONE side of the garden, so multiply this by 4

8*4=32  

Next we want to see the number of links it takes to build the garden

Since one link measures 2 2/3 feet you have to divide

32/ 2 2/3 (32 divided by two and two-thirds)

to get an answer of : 12 links

It isn’t loading for me

How much greater is the volume of a triangular prism with base area of 15 cm^2 and height of 3.8 cm than the volume of a triangular pyramid with the same height and base area

Answers

28.5 is the Answer i thinck i do not now i forgot how to do it in college we do not do that any more

Jay and Sally shared an apple pie and ate 1/2 of it. Later, Jay went back and ate another 1/8 of the pie while Sally ate another 1/4. How many pieces of the pie are left? (Hint, add the fractions (common denominator_, that will tell you how many pieces they ate). I want to know how many are left over.

Answers

1/8 of the pie is left

Explanation : convert the 1/2 into 4/8 and 1/4 into 2/8 add them together and you’ll get 6/8 + the 1/8 of the pie that Jay eat giving you 7/8 of the pie eaten.

The line that passes through the point (2/3, 5/9) and is perpendicular to the x-axis?

Answers

Answer:

im not sure

Step-by-step explanation:

The only way that’s possible is if x=2/3 and it’s a vertical line upwards

ANSWER FOR BRAINLIEST

The circumference of a circle is 17π ft. Find its radius, in feet.

Answers

Answer:

howdy

Step-by-step explanation:

2.71 is the answer i think

(08.01)Which of the following statements shows a characteristic of a statistical question?

The question is focused.
The distribution can be broken into categories.
The question asks for a quantitative response.
The question allows for surveys to be conducted.

Answers

Answer:

The guy above me already said it, it's C

Which statement about sales tax is NOT true?

You can find the amount of sales tax in a sales tax table.

The sales tax is based on the value of an item.

The sales tax is the same as income tax.

You need to know the price of the item to determine the sales tax.

Answers

Answer:

the sales tax is the same as income tax

Step-by-step explanation:

sales tax is the same as income tax

(all the other answers are clearly correct)

Need the answer ASAP... (I will report you if you put weird answers to get points)

0.75 of the adults in a hall are women. If there are 125 men, how many adults are there altogether?

Answers

I think the answer is 500
If there are x adults total, and 0.75 of them are women, then you have 0.75x women total. it is given that you have 125 men.
since men plus women equals total adults, 0.75x+125=x
125=0.25x
x=500
use socratic or photomath

A regular pentagon with side length s has perimeter 5s. Dakota built a dog pen in her backyard for her dog's new puppies. The pen is shaped like a regular pentagon and has 40-inch sides.
What is the perimeter of the pen?
Write your answer as a whole number or decimal.

Answers

Answer: a little hard

Step-by-step explanation:

The required measure of the perimeter of the pen is 200 inches.

Given that,
The pen is shaped like a regular pentagon and has 40-inch sides.
The perimeter of the pen is to be determined.

What is a polygon?

A polygon is defined as a geometric shape that is composed of 3 or more sides these sides are equal in length, and an equal measure of angle at the vertex,

Examples of polygons, equilateral triangles, squares, pentagon etc

Here,
A regular pentagon with side lengths has perimeter 5s.
So,
Perimeter of the pen = 5 × 40 = 200 inches

Thus, the required measure of the perimeter of the pen is 200 inches.

Learn more about polygon here:
https://brainly.com/question/24464711
#SPJ2


Brandon is treating his parents to dinner at Pizazz Pizza. The total cost of the meal includes a 15% tip and 8% tax.

If the cost of the meal before the tip and tax are added is represented by P, which expression models the total amount that Brandon pays?
A) P + 0.15P + 0.08P
B) P(0.15P − 0.08P)
C) P −(0.15P + 0.08P)
D) P + 0.23

The price (P) of a model car kit is $15. If the sales tax on the purchase is 9%, which expression models the cost of the kit including the tax?
A) 0.91P
B) 1.09P
C) 1.15P
D) 15.09P

HELPPPPP PLEASEEEEE!!!!!

Answers

Answer:

The first question is A) P + 0.15P + 0.08P

The second question is B) 1.09P

Step-by-step explanation:

The cost of the dinner is the amount for the dinner, P plus the tax, 8% of P, which is 0.08P, plus the 15% tip, which is 0.15P

The cost of the car is P, or $15, plus the tax is 9%, or 0.09P

P + 0.09P = 1.09P

1st one is A because you wouldn't add them together first and you wouldn't subtract so that gets rid of B, C, and D.

2nd one is B, its really easy because you would just add 0.09 to the 1.00 to get 1.09

Let a equal measure of a angle a. The equation 360゚= a + 90゚+ 135゚+ 75゚ represents the sum of the angles in the quadrilateral. Find the missing angle measure by solving the equation.​

Answers

Answer:

A = 60°

Step-by-step explanation:

First to find the missing angle you add the three known angles,

90 + 135 + 75 = 300

Then, you subtract, 360 - 300 = 60

So, 360° = 60° + 90° + 135° + 75°

Answer:

A = 60 percent

Step-by-step explanation:

PLEASE HELP ASAP!!
[tex]\frac{3}{4}[/tex] t = -9 what does t equal?

Answers

Answer:

-12

Step-by-step explanation:

simplify then multiply then simplify again then divide and then simplify one last time

the answer is -12!!!!!

sorry guys but i have a lot more ques

A $300 mountain bike is discounted by 30%. What is the sales price of the bicycle?

Answers

Answer:

The price f the bikes is 90$

Step-by-step explanation:

Because 30% of 300 is 90.

To find a percentage .3 times 300 = 90 so subtract the sale from og price to get sale price (300-90)=210

I do not get this what why is math so hard aaaaaaa due tmr morning btw qwq

Answers

Answer:

arent all triangles automatically 180

Step-by-step explanation:

Answer:

Because in math u is texting me child

Step-by-step explanation:

Order these numbers from least to greatest 1/5 0.5 0.05 0.23 1/3

Answers

0.05
1/5 (0.2)
0.23
1/3 (0.33)
0.5

(2, -7) and (5, -4) find the slope of this line


NEED AN ANSWER ASAP

Answers

Answer:

slope = 1

Step-by-step explanation:

The slope in this question is equal to 1 I believe

There are 8 swimmers in the swimming club. The club bought c swimming caps to split among its members. Write an expression that shows how many swimming caps each swimmer will get.

Answers

Answer:

c/8

Step-by-step explanation:

This is division. This can be figured out by reading "split". If something is to be split, it is the dividend.

The answer to the question is c

i need help and if u get the answer plz explain it

Answers

10 hours. I dont know if it’s right but you just divide 150 by 3 and divide that by 500

Answer:

G) 10 Hours

Step-by-step explanation:

150/3= 50 miles per hour

500 miles divided by 50 is 10 hours

help if you answer correctly I will make you brainly!

Answers

Answer: B

I devided each classes fund money and B was the highest each student gave $17

What is the area of pizza with a diameter of 14 inches?

Answers

Answer:

153.94

Step-by-step explanation:

Answer:

153.86 square inches I hope this is right have a great day

Cara loves to compete in triathlons. At a race a few months ago, she finished in 170 minutes. Yesterday, she completed another triathlon and finished in the same amount of time. What was the percent of increase in Cara's finishing time?

Answers

0% it stayed the same so there’s no increase

THIS LOOKS IMPOSSIBLE

Answers

Answer:

Dang hes smart as heck bro it is 80 Sq cm He deserves brainliest

Step-by-step explanation:

Other Questions
16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E. Which point would map onto itself? Write a rule for the reflection.(x,y) = ( , ) suppose a collection of five batteries is connected as shown in the figure, in which b1 = 4.1 v.