Please help me due tonight!

Please Help Me Due Tonight!

Answers

Answer 1

Answer:

Meiosis I ==> Interphase - Prophase - Metaphase - Anaphase - Telaphse - genes

Meiosis II ==> Prophase - Metaphase - Anaphase - Telaphase - genes

unlike mitosis which has only one form


Related Questions

You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes

Answers

The answer would be A.thunderstorms

Hope this helps

Have a great day/night

Which belongs in each place

Answers

Answer:

1=e, 2=b, 3=c, 4=d, 5=a

Explanation:

.

Identify the advantages and disadvantages of internal and external fertilization

Answers

When a sperm fertilizes an egg within the female, it is known as internal fertilization. The advantages of internal fertilization are that the fertilized egg is protected from predators and harsh environments, thus ending in higher chances of survival. Also, there is a lesser chance of desiccation of gametes. Disadvantages of internal fertilization are that there are lesser number of offspring produced at a given time because it is sometimes difficult for the male and female to come into intimate contact. Additionally, the risk of sexually transmitted diseases also increases.

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths

Why do the cells used for reproduction only have half (½) of the DNA that other cells have?

Answers

Answer:

Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.

Explanation:

Write a sentence about tissues. (ITS FOR SCIENCE SO PLS)

Answers

Answer: There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue. Connective tissue supports other tissues and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of the various passages inside the body)

Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these​

Answers

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

What abiotic factors might affect a population of fish? Check ALL that apply.

clear water
light
temperature
food

Answers

Answer:

Clear water, light, and tempature.

Explanation:

Please help I'm behind

Answers

Answer:

B : Barometer

Explanation:

A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking

True or false the main source of energy and water cycle is gravity

Answers

Answer:

False please mark me brainlest.

Explanation:

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

True or False: Epinephrine enters
the cell after it binds to the receptor.

Answers

i believe it’s true ...

Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.

What are the functions of epinephrine?

Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.

Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.

Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.

Learn more about epinephrine:

https://brainly.com/question/3882731

#SPJ2

5. Why might a cell need to phagocytose?

Answers

Answer:

Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.

Explanation:

The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?

A.
the liquid will become a solid

B.
the temperature of the liquid will increase

C.
the temperature of the liquid will decrease

D.
the molecules will gain mass

Answers

Answer:

I believe the answer to this question is B

What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

Answers

Answer:

B.

Explanation:

If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.

Answers

Answer: C.

has different alleles on the chromosomes in a chromosome pair

Explanation:

Hetero means different.

A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.

What is the particular trait for heterozygous organism?

When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.

Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.

The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.

Therefore, has different alleles on the chromosomes in a chromosome pair.

Learn more about heterozygous here:

https://brainly.com/question/29327683

#SPJ2

The electrons that travel through electron transport chain #1 (and that have been excited off of the chlorophyll molecules on photosystem #2) are used to

Answers

Answer:

energy released in these electron transfers is used to form an electrochemical gradient. In chemiosmosis, the energy stored in the gradient is used to make ATP.

Explanation:

Hope this helps :)

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Answers

Answer:

A. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.  - 3.dangerous.

B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.

C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say. - 2.conciliatory.

D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .

Explanation:

The given underlined words in each sentence are-

1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.

2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.

3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.

4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.

Answer:

- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.

- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.

- 2.conciliatory.

He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say.

- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Explanation:

Which natural resource is nonrenewable?

sunlight


sugarcane


oil or petroleum


corn​

Answers

Answer:

There are four major types of nonrenewable resources: oil, natural gas, coal, and nuclear energy. Oil, natural gas, and coal are collectively called fossil fuels.

The natural resource is nonrenewable oil or petroleum is a carbon primarily based totally gasoline .

What are nonrenewable resources?

There are 4 essential varieties of nonrenewable resources: oil, herbal gas, coal, and nuclear energy.

Oil is a carbon primarily based totally gasoline that bureaucracy while plant and animal stays are uncovered to intense situations which include excessive pressure (eg below a dust layer on the sea floor.) for hundreds of years. Therefore the oil we use these days took millennia to form.

Read more about oil here:

https://brainly.com/question/25614315

#SPJ2

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Summarize in 2-3 sentences, how an RNA vaccine works to help protect you against
viruses?
I

Answers

Answer:

boost your immune system

Explanation:

Answer:

Vaccination is the process in which substances called antigens are introduced artificially into the body to stimulate the immune system, the set of cells that protects the body against infections .

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

Other Questions
NEED ANSWER ASAP Which type of Symbiotic Relationship is described below?When two organisms interact with one another and one is benefited, and one isn't benefited or harmed. aMutualism bCommensalism cParasitism Rewrite the fraction as a decimal.19/50= plx help i need to get this so I can be ungrounded Find the quotient: 8,358 27 = ________.309 r 15309 r 26310 r 15310 r 26 What is the best reply to the question "Qu tal?"?A. Encantada.B. Gracias.C. Bien, gracias.D. Cmo te llamas? What is the base for the follwing problem log100=2 1.Which of the following is not an attribute of an individual person? A. Establish Culture B. Others opinionC. ReasonD. Self conscious 2.Which is done repeatedly that could make or break us? A. Capability B. Personal habitC. Responsibility D. Strength What is the difference between an appointment and a meeting?O An appointment does not require coworkers, but a meeting includes coworkers.O An appointment is for personal obligations, but a meeting is work related.O An appointment does not have a location, but a meeting has a specific site.O An appointment is for tasks to accomplish, buta meeting is a time slot on the calendar. WHICH COMPOUND HAS BONDS WITH THE LEAST DEGREE OF POLARITY (LEAST POLAR)? At the end of school, Josh's teacher handed out 27 coupons for bowling during the summer to each student. The third week ofsummer, he accidentally threw away 15 of them when he cleaned his room. The last week of summer, he decided to use theremaining coupons evenly over 3 days.If he did not use any of the coupons until the last week of summer, how many coupons did he use on each of the 3 days? what is x of the equation 3(2x+1)+11=-2(2x-2) What is an analytical statement? Sam is moving house and is carrying a 300N box of books up a flight of steps 5m high, it takes her 30 seconds. Gary follows her carrying a bag of clothes doing 1000 J of work; it only takes him 25 seconds. Who provides the biggest power? Show your working. A student made the table shown to list some contact and non-contact forces.Examples of ForcesContact Forces Non-Contact ForcesThe force exerted by a stretched spring The force applied by Earth and sun on each otherThe electrical force exerted by a positive charge on a negative charge Magnetic attraction between two magnetsWhich statement best explains why the table is incorrect? Spring force is a force acting at a distance. Electrical force is not a contact force. Gravitational force can act between planets and sun only when they are in contact. Magnetic attraction is a contact force I need to know if this is right!! A key source of power during the industrial revolution was Every month, Ms. Thomas pays her car loan through automatic payments ( withdrawals) from her savingsaccount. S he pays the same amount on her car loan each month. A t the end of the year, her savingsaccount balance changed by $2,931 from payments made on her car loan. Please help Due Tomorrow Which of the following best describes the effects of the trade routes on the societies of West Africa?They increased the average persons standard of living, leading to increased freedom and greater gender equality.They led to larger urban cores that used professional armies to increase their territory and enslave people.They disrupted major empires, paving the way for an increase in religious diversity.They led to deindustrialization as imported goods destroyed local crafts, creating economies based on raw resource extraction. I have to do a book report but I dont know what to do so please help and if u did thanks1. State the title of the book2. How many pages 3. 120 characters at least of the summary of the book