Answer:
...
Explanation:
Cyanite (Al2SiO5), quartz (SiO2), and leucite (KAlSi2O6) may be grouped together because they are all part of the largest mineral group called:
Answer:
Explanation:
Cyanite, quartz and lucite are all part of the potassium mineral group
The study of chemicals and bonds is called chemistry.
The correct answer to the question is potassium.
What are minerals?A mineral or mineral species is, broadly speaking, a solid chemical compound with fairly well-defined chemical composition and a specific crystal structure that occurs naturally in pure form. The geological definition of mineral normally excludes compounds that occur only in living beings.According to the question, all these minerals belong to the potassium group.
For more information about the minerals, refer to the link:-
https://brainly.com/question/14688752
What happens to the amount of free water when you add salt to water
Answer:
it mixes i think lol
Explanation:
QUICK! 30 POINTS
D is crossed out because it is wrong.
Answer:
C. There is a loss in energy
Explanation:
Give two reasons why photosynthesis in plants slows down then stops during the fall then winter.
Answer: In the winter and fall there is less sunlight and there is less rain
There is a decline in photosynthesis after the sun sets in the winter and fall seasons. There is a decline of the enzymes in the plants that are responsible for the biochemical reaction.
These don't tend to work so so well during the winter cold winds blowing slows down the plant respiration process and hence the less photosynthesis to for the plants. Hence few sugars are not turned into metabolism.Learn more about why photosynthesis in plants slows down.
https://brainly.com/question/1050630.
Cookware companies have been using a chemical called C-8, which helps to create a nonstick coating to pans. However, the Environmental Protection Agency (EPA) recently claimed that the use of C-8 in the manufacturing of nonstick cookware should be discontinued because studies show it causes cancer.
Who might benefit financially the most from the EPA’s claim?
Answer:
Explanation:
The choices provided are:
a.restaurants that use C-8-coated cookware
b.cookware manufacturers who make pans out of steel only
c.stores that sell C-8 nonstick cookware
d.individuals who use steel cookware at home
From these choices B is the correct answer.
Restaurants that use C-8 cookware will not profit from using it but will need to lose money by replacing the old C-8 coated cookware.
Stores that sell this nonstick cookware will also need to replace their inventory so they won't be making extra money, only losing it.
And individuals at home will still be using steel cookware and won't benefit or lose anything by this change with the regulations of the c-8 coated nonstick cookware.
Help me with this
A . Name the separation technique that can be used to separate lighter particles and heavier particles. Explain the principle behind this separation method
Answer:
Purification techniques
Answer:
It is just the techniques purification
Explanation:
Which of the following is NOT a function of the skeletal system?
A, Providing a framework for muscles
B. Creating new blood cells
C. Fighting disease
Answer:
From help from another user my answer was wrong to begin with the answer is C.
Explanation:
Most blood cells are created in bone marrow, the spongy substance found inside the bone structure.
B is a function of the skeletal system
The bones make the frame work of the body which allows us to stand and keep structure instead of being like slime.
A is a function of the skeletal system
ONCE AGAIN: The correct answer is C
-Salicylic acid is a naturally occurring chemical produced in willow trees.
Salicylic acid is used by humans in some acne products to kill bacteria that
cause skin irritation
Based on this information, what stimulus most likely causes willow trees to
increase the production of salicylic acid?
Freezing conditions that damages leaves
Changing seasons with less direct sunlight
Damage to the bark of the tree trunk
Exposure to pathogens in the vascular tissue
Answer: D on eduphoria
Explanation:
If Jamal does not sleep for four days straight, he will most likely experience __(blank)__. a) jet lag
b) psychopathic behavior
c) hallucinations
d) REM
Answer:
b? ig I mean u could experiance all, but this is an 8th grader talking what do i know?
Explanation:
Define concentration gradient.
Answer:
A concentration gradient occurs when the concentration of particles is higher in one area than another. In passive transport, particles will diffuse down a concentration gradient, from areas of higher concentration to areas of lower concentration, until they are evenly spaced.
Recovering Ecosystems Worksheet Section 1: Select the Kitakami River region, the Abukuma Highlands, or Japan's coastal habitat as the ecosystem you want to help with recovery. List the main problem faced by this ecosystem as described in the lesson. Then list at least two sub-problems that need to be considered to solve the main problem. List the sub-problems in order of most to least important. In the rationale column, explain why you placed your sub-problems in the order you selected. Main Problem Sub-Problems Rationale Section 2: Conduct internet research on your selected ecosystem to help you generate a list of three criteria and two constraints. Your criteria and constraints should consider relevant factors to the problem, such as costs, reliability, safety (to humans and wildlife), human needs, environmental impact, local biodiversity, and the aesthetics of the area. List the criteria in order of most to least important and assign each to a related sub-problem. In the rationale column, explain why you placed your criteria in the order you selected. Constraints Criteria Rationale Which Sub-Problems does this criteria address? Section 3: For at least one of the sub-problems, propose two solutions based on the information from the lesson and your additional research. In the rationale column, explain how your solution restores the stability and biodiversity of your selected ecosystem. Sub-Problem Proposed Solutions Rationale Section 4: Answer the following analysis questions about your proposed solutions. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?
Answer:
the screen shot is the answers when you select kitakami River region
Explanation:
sorry this isn't the full answer this is all have myself at the moment.
Answer:
Explanation:
the links are images of the answers
Why is meiosis important for organisms?
It allows for genetic variation among organisms.
It determines which genes are dominant and which are recessive.
It produces genetically identical cells.
It provides a means of asexual reproduction.
IM TIMED
Answer:
A - It allows for genetic variation among organisms.
Explanation:
Its basically sex or sexual reproduction. Which later allows for genes to spread and vary. Which create families in animals and humans.
Because Meiosis is Sexual Reproduction
Hope this Helps!
:D
find the kinetic energy of a ball of mass 200 grams moving at a speed of 20m/s
Answer is 40J...............
For this assignment, you will first make a model of a DNA strand using pop beads. This DNA strand
codes for a protein, which determines a trait in an organism. Next, you will change the base sequence of
your model in three ways to show how mutations occur. Then, you will compare the base sequence of the
mutated models to sequences on a key provided by your teacher to find out whether the mutated strand
creates a protein that is beneficial, harmful, or neutral. Finally, you will answer some questions to
summarize what you have done in this project. The Student Worksheet on the last few pages of this
document will help you complete your assignment.
Background Information
DNA is the genetic material passed from parent to offspring. It is an important molecule because it carries
instructions used for producing proteins. These proteins determine how an organism looks and functions.
DNA is a double-helix molecule. The two sides of the molecule, its backbone, are made of sugar
molecules and phosphate molecules. These sides are connected by rungs made of nitrogen bases. The
nitrogen bases of DNA are adenine (A), thymine (T), cytosine (C), and guanine (G).
A gene is a segment of DNA that codes for a specific trait. The sequence of nitrogen bases in a gene is
copied from DNA into a strand of RNA in the nucleus of a cell. The RNA then moves out of the nucleus to
the ribosome. The ribosome uses the information that RNA copies from DNA to produce proteins that
have specific shapes and functions. The shapes of proteins help them perform their job. If the shape of
the protein is changed, the protein may not be able to perform its function. A mutation, which is a
permanent change in the DNA sequence in a gene, may change the shape of the protein it codes for.
Types of mutations include substitution, insertion, and deletion. The effects of mutations on organisms
may be beneficial, harmful, or neutral.
Answer:
This type of mutation occurs when one or more base pairs are added to the gene sequence.
✔ insertion
This type of mutation occurs when one or more base pairs are removed from the gene sequence.
✔ deletion
This type of mutation occurs when one or more base pairs take the place of other base pairs in the gene sequence.
✔ substitution
Question:
Do you remeber the answer you turned in for this? If you do, can you please give it to me????? That would help a lot
two features of indirect democracy
Answer:
trump
Explanation:
What are the organs in the circulatory system
Answer:
The circulatory system consists of three independent systems that work together: the heart (cardiovascular), lungs (pulmonary), and arteries, veins, coronary and portal vessels (systemic). The system is responsible for the flow of blood, nutrients, oxygen and other gases, and as well as hormones to and from cells.in which direction will air currents most likely move
A. from the land to the sea
B. straight up above the sea
C. from the sea to the land
D. straight down over the land
how does the nervous system send messages to the other parts of the body
Answer:
by signals that the nervous system sends to the brain
Explanation:
A student experiments with two solutions containing the same solute concentrations
in a beaker that is divided by a semipermeable membrane, as shown.
In which direction will the water move so that the concentrations of the solutions
remain constant on both sides of the membrane?
A in both directions at different rates
B in both directions at the same rates
C toward the right side of the beaker
D toward the left side of the beaker
Answer:
B in both directions at the same rates
Explanation:
Solutions with the same amount of solute concentration is referred to as ISOTONIC. In an isotonic solution, there is NO net movement of water molecules because there is no osmotic gradient i.e. difference in solute concentrations.
In this case, a student experiments with two solutions containing the SAME SOLUTE CONCENTRATIONS in a beaker that is divided by a semipermeable membrane. Due to the equal amount of solute concentrations in both solutions, water moves into and out each membrane at an equal rate.
In order for the concentrations of the solutions to remain constant on both sides of the membrane, WATER MUST MOVE IN BOTH DIRECTIONS AT THE SAME RATE.
Which of the following explains why a mountain can become flat after millions of years?
Weathering and erosion cause the soil from the mountain to erode down the mountain's slope.
Heat from the sun causes the soil to dry out, decreasing the mountain's volume and causing it to sink
Animals walking and running across the land compact the soil over time until it becomes flat
The mountain crumbles away after losing all its nutrients because there are too many trees
Answer:
weather and erosion
Explanation:
Global climate has changed in the past due to 1. __ and 2. __
1- air pollution
Earthquakes
Or plate tectonics
2- milankovitch cycles
Lunar phases
Or global warming
Answer: I think its air pollution and Global warming
Explanation:
Answer:
The answer is actually 1. plate tectonics and 2. Milankovitch cycles.
Explanation:
I got this correct on odyssey
Sally conducts an experiment measuring plant growth. She finds that after two weeks, a plant that receives water grew 4 cm, but the plant that received soda died. What is the term for what is being measured?
Answer:
The correct answer is - the dependent variable.
Explanation:
In any study or research, the variable is that measured or affected by the change occurs lace in an experiment is called the dependent variable. The dependent variable depends on the factors or the variables that are changed in the experiment.
In this particular study, the variable which is measure is the height or growth of the plant which depends on the change in the hydrating supply so the dependent variable will be - the growth of the plant.
Ricin is a chemical that has the effect of blocking eukaryotic ribosomes from performing translation. Why is this a dangerous chemical?
Answer:
if the ribosomes can’t perform translation, the human won’t be able to perform synthesis. this will kill the eukaryotic organism.
Explanation:
Which macromolecule and function are correctly matched? *
A. Lipids are used to build things like your hair, skin, nails, and muscles and are also
enzymes
B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.
C. Proteins and Lipids give us energy.
D. Carbohydrates contain your genetic information.
Answer: B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.
Explanation:
draw a diagram that tracks how the suns energy gets to a fox. In your diagram, label each organism as heterotroph or an autotroph
I have edited a picture from Google for you. Hope it helps. You just have to replace the tiger with a fox.
Hope it helps
The fox ( heterotroph) gets energy by eating other animals who in turn eats plants(autotroph)
What are heterotroph?Hetero- other and trophe- nourishment.Organism that eats plants or other animals are called heterotroph.What are autotrophs?Auto- self and trophe- nourishment.Organism that makes their own food is called autotrophs.Hence, the diagram given below shows how the sun energy gets to a fox.
To know more about autotroph here
https://brainly.com/question/25420230
#SPJ2
Most of our dreams are about __(blank)__.
a) every day things and problems
b) childhood experiences
c) strange and unusual objects
d) repressed memories
what adaptations facilitated movement of tetrapods to land - be sure to describe challenges that these adaptations helped them overcome.
Answer:
The second neck vertebra evolved to allow rotation of the neck for moving the head left and right. As tetrapod species continued to evolve on land, adaptations included seven or more vertebrae, allowing increasing neck mobility.
Explanation:
what is meant by locomotor skill
Answer:
Body moving from one place to another in a vertical plane. Develop bodily control. Walking, running, leaping, jumping, hopping, galloping, sliding, & skipping.
Explanation:
Cellular respiration refers to _____.
A releasing cellular energy through secretion
B the synthesis of cellular materials
C breathing
D the breakdown of sugar molecules in food to release energy
Answer:
D
Explanation:
Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.
Answer:
D. The breakdown of sugar molecules in food to release energy.
Explanation:
Cellular respiration is converting the glucose in your food to ATP in the mitochondria of the cell to produce energy for living.
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
Exercise 1:
DNA ATACGAAATCGCGATCGCGGCGATTCGG mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|SerExercise 2:
DNA TTTACGGCCATCAGGCAATACTGG mRNA AAAUGCCGGUAGUCCGUUAUGACC CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr