PLEASE HELPPPPPPP(Monstro the Goldfish & Epigenetics)

Biology High School

PLEASE HELPPPPPPP

(Monstro the Goldfish & Epigenetics)

Answers

Answer 1

Answer:

mmmmmmmmmmmmdddddd

Explanation:

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

Related Questions

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

Which other food items were digested by lactase, the enzyme that breaks down milk?

Answers

Answer:

im not sure what you mean by this question but ill answer the best way i can!

Explanation:

Bread and baked goodsMilk chocolate and some candiesSalad dressings and saucesBreakfast cereals and cereal barsInstant potatoes, soups, rice and noodle mixesLunch meats (other than kosher)Cheese flavored crackers and other snacks

these are foods containing lactose in them, which lactase breaks down.

hope this helps!

How is evaporation related to precipitation?

Answers

Since Precipitation is rain evaporation is water which is turning in to gas and goes to the air or atmosphere

WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
and RNA?
A. Transcription and translation
O B. Asexual and sexual reproduction
C. Photosynthesis and respiration
D. Mitosis and meiosis

Answers

Answer:

Explanation:

Thats the tea

Hope this helps ;)

The process that expresses the information encoded by DNA and RNA is Transcription and translation, so option A is correct. Transcription is the process by which the genetic information stored in DNA is transcribed into RNA.

Transcription is the process by which the genetic information stored in DNA is transcribed into RNA. It involves the synthesis of an RNA molecule using one strand of DNA as a template. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the site of protein synthesis. Translation, on the other hand, is the process by which the information encoded in mRNA is used to synthesize a specific protein. It takes place in ribosomes, where transfer RNA (tRNA) molecules interpret the genetic code on the mRNA and bring the corresponding amino acids to assemble the protein chain.

Learn more about transcription and translation here.

https://brainly.com/question/29979094

#SPJ2

please answer this for me

Answers

Answer:

Im pretty sure its A the phagocytes.

Explanation:

all you need is in the photo

Answers

Answer:

Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.

Explanation:

hope this helps if not i'll try to figure out the answer for you

the final phase of mitosis characterized by the separated chromosomes reaching the poles
of the cell. The nuclear membrane and nucleolus begins to reappear around each set of
chromosomes

Answers

Answer:

Telophase

Explanation:

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

20 points and brainliest! Explain how you got the answer!

Answers

Answer:

No of groups studied

As All other factors will effect the result ofvthe experiment.

But no matter how many groups you take to study they will show the same result

HOPE YOU GOT IT!

MARK ME AS BRAINIEST

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

Which of the following characteristics of carbon is responsible for the variety of carbon-based molecules on Earth?

Answers

Answer:

It can form bonds.

Explanation:

(I'm in ap bio so I know a lot, lol, hope that helps)

submit this form. Not you? Switch account
* Required
3. How do the biotic factors in an ecosystem depend on the abiotic factors

Answers

Answer:

biotic factors depend on abiotic factors for survival

Explanation:

Searches related to what are some of the factors foresters have to consider before making decisions? help meeeee

Answers

forest fires,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE

Explanation: hope this helps

i am so confused is this an actual question or is it just random letters?-

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :( .......

Why do you think that some definitions of forest have a certain percentage of the land that must be covered in trees?

Answers

Answer:

30 percent tree cover - 2000 - 2009JPEG ... of forest cover vary widely—as much as 6 percent of Earth's land area, or the equivalent area of China.

Explanation:

What are the 3 main types of star "corpses"? plz hurry

Answers

Answer: white dwarfs, neutron stars, and black holes

Explanation:

The folded plasma membrane inside the cell is the ______.
A: endoplasmic reticulum
B: mitochondria
C: vacuole
D: vesicle

Answers

A is the answer because this the only thing that folds

please help meeeeeeeeeee

Answers

Answer:

Explanation:

D like the person above

Two offspring from same parents can have different phenotypes. How is this possible?

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

please help with this question

Answers

Answer:

Explanation:

the answer is C bc I read this and u can site it in the text

PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.

Answers

Answer:

No, not according to any sciences (unless you mean aliens as in immigrants)

Explanation:

There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.

HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.

Answers

Answer:

No, because the scientist followed personalities which is pseudoscience.

Explanation:

A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period

Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.

People born in October were more relaxed and could better handle stress

Is the scientist’s research considered science?

No, this are beliefs not necesarily true.

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen

Answers

Answer:

Carbon dioxide

Answer:

Carbon Dioxide

Explanation:

i need some help on this i dont know can someone plz help me

Answers

Answer:

D is your answer I believe

1. Would you consider a Zonkey (baby created from a donkey raised with a zebra) alive? Keep in mind that a Zonkey is sterile and cannot produce its own offspring.

2. Would you consider a virus alive? It requires a host completely to live.

Answers

Answer to 1:Yes the Zonkey is alive,not all organisms can reproduce. Some people are born with rare genetics were they can't give birth,so even if the Zonkey is sterile and can't produces it own offspring it is alive.

Answer to 2:Yes a virus is alive,it attacks the host and contains/kill other cells in your body. They also can multiple. If they can multiply and even attack and kill other cells they are alive.

Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.

What statement is best supported by this information?

A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.

Answers

Answer:

Explanation:

Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.

Explanation: just did the test its right.

Other Questions

Find the radius of the given circle with the center at (-2,1) and a point on the circle at (0,3). Clever ones this is one for youIf you throw a pebble into apond, ripples spread out from where it went in. These ripples arewaves travellingthrough the water. Thewaves movewith a transversemotion. The undulations (up and downmovement) are at 90 to the direction oftravel. what is abortion?what is veneral disease? Gregor Mendel is examining peas to try to understand how traits are passed from parents to offspring. Today, Gregor has 228 peas to examine. The pods have 6 peas per pod.How many pods of peas are there? I have no idea what the answer is Can someone please help me answer this could someone help me? thank you Source 1It cannot be denied that when the French nation proclaimed these sacred words, Men are born and remain free and equal in rights, it did not break the chains of humankind. It is we who must put these words into action. The wealthy plantation owners of Saint-Domingue [Haiti], therefore, have everything to fear from the influence of our revolution on the current actions of their slaves. These principles overturn the system on which rests their fortunes. No one should be surprised, therefore, that these plantation owners have become the most ardent enemies of these principles. Yet the moment has arrived to change the social system of the colonies, to reintegrate it into humankind. It is in this greater action that the salvation of all parties, justice, and glory will be found.The free men of color demand justice, and they should be granted the same rights of citizenship as other Frenchmen. The colonists should no longer refuse them. The artisan slaves should also be called to freedom on the condition that each slave pays a one-time tax for freedom. The other Black slaves may enjoy a conditional liberty, namely that they remain on the land of their masters and work that land for a period ranging between 10 and 20 years depending on circumstances. Afterward, they may obtain the same full liberty as the artisan slaves.Armand-Guy Kersaint, French nobleman and deputy in the National Legislative Assembly of France, address to the Assembly, Paris, 1792Source 2To bring the Blacks of Saint-Domingue back to their original condition of slavery is impossible: the writings of the philosophes have spread over the surface of the globe and neither superstition nor despotism can extinguish their ideas. Everything is headed toward general freedom, everything tells you that man will no longer be the slave of man. Tear off the fatal blindfold: the colony of Saint-Domingue will no longer be cultivated by the hands of slaves.But, some will object and say, The Blacks wont work anymore once they are free. White hands will never suffice to work the land under a burning sun; in short, the colony cannot survive without slavery. I understand you, cold egoists, men without feeling! You need slaves, that is, men you can treat like beasts of burden; you need slaves, that is, victims. What law forces a man to give another man the entire fruit of his labor? This Black individual is free, because neither the nation nor the Supreme Being created slaves. He is your equal, because he is a man. He is a French citizen, because he serves the country, because he contributes to its splendor as much as you do, and because the French nation loves all its children equally. In exchange for his labor, the Black man will receive a salary proportional to his effort.H. D. de Saint-Maurice, French journalist, newspaper article written following the destruction of the largest French city in Saint-Domingue, published in a French newspaper in Saint-Domingue, 1793Which of the following most directly influenced the arguments about social and economic change in Saint-Domingue expressed by Kersaint and Saint-Maurice in the passages?A.MercantilistsB.AbsolutistsC.Laissez-faire capitalistsD.Enlightenment thinkers Your values come from many different sources. Which is one source that can influence your values?1.cooperation2.ability3.media4.choices An assistant cook peeled 18 potatoes in 6 minutes. At this rate, how many potatoes can he peel in 50 minutes? A food store makes a 11-lb mixture of oatmeal, crispies, and chocolate chips. The cost of oatmeal is $1.50 per pound, crispies cost $2.00 per pound, and chocolate chips cost $1.00 per pound. The mixture calls for twice as much oatmeal as crispies. The total cost of the mixture is $17.00. How much of each ingredient did the store use? What did Jefferson think about the people's role in government? A. believed that the common man was not educated enough to make governmental decisions, so he wanted the federal government to have significant power B. placed his trust with the people, and believed that popular sovereignty was critical to democracy. Help me pls its due today A shoe store uses a 38% markup to price their items. The store buys theshoes from the wholesaler for $52. By how much will they mark up the price? All stages of plant development are called? Hi, are these correct? You are going to write three sentences using Le futur proche.1. je vais tudier.2. Il va a la campagne.3. Nous allons nager. The correct electron configuration of the O2-ion isA)2-4B)2-5C)2-7D)2-8 Which statement accurately describes radioactive dating?a. Geologists use only one type of radioactive dating.b. Geologists compare parent and daughter elements to determine rock type.c. Geologists will measure how stable multiple parent elements can decay into multiple daughter elements.d. Geologists compare the observed abundance of naturally occurring radioactive isotopes and their decay products using decay rates. Tobacco use can lead to which of the following Harold opened a credit card at a department store with an APR of 14.55% compounded monthly. What is the APY on this credit card?