PLS ANSWER QUICKLY AND ILL MARK U BRAINLIEST
What is one similarity between a sitcom and one-act play
specific types of jokes
they both have one act
a main message
one main character

Answers

Answer 1

Answer: main message


Related Questions

The main idea is usually found in the
sentences of a paragraph.
O A. first or last
B. middle
O C. first
O D. last

Answers

the main ideas is normally found in the middle

what did aristotle believe are the three forms of hapiness?

Answers

Answer:

Aristotle believed in 3 forms of happiness, the first form is life of pleasure and enjoyment. The second form of happiness is a  life as a free and responsible citizen. The last form of happiness is is a life as thinker and philosopher.

Explanation:

Which line from "The Medicine Bag' contains dialogue? He said this in such a way that no one could argue with him. My friends kept asking to come see the old man, but I put them off. Grandpa relaxed, and between sips of soup, he told us of his journey. "You found the money in my boots?" he asked Mom.​

Answers

Answer:

d: "you found the money in my boots?" he asked mom.

Explanation:

Answer:

D is the answer

Explanation:

what is meaning for leg
in hindi

Answers

Answer:

टांग or taang

Explanation:

Answer:

टांग is leg in hindi

Explanation:

Question 1 of 10
Read the following lines from "Wash of Cold River" by H. D.:
rare, pure of texture
beautiful space and line,
marble to grace
your inaccessible shrine.
How do these lines show elements of formal verse?
O A. They show a clear pattern of end rhyme.
O B. They have the same number of syllables.
O C. They follow a structure similar to a ballad.
O D. They are written in strict iambic pentameter.

Answers

Answer:

apple

Explanation:

The lines of the poem show the end rhymic structure where the last words end with a rhyme.

What do you mean by the end rhyme pattern of poem?

End rhyme patterns of the poem where the ending words of the poem sound similar in rhymic tone. This kind of rhyme helps the reader to remember the poetry for a  long time.

This poem states the natural beauty of the earth and compares it with feminism through different adjectives.

Therefore, in this poem both the lines are ends with similar sounds like "line" and "shrine" which shows the end rhyme pattern.

Learn more about the end rhyme pattern, here:

https://brainly.com/question/14694356

#SPJ2

Why does the narrator call himself “nervous” but not “mad” in paragraph 1? What does
this tell us about him? How does the author’s point of view impact the telling of the
story?

Answers

Answer:

This shows that the narrator is a shy person or an introvert and becomes nervous easily

The narrator calls himself nervous instead of mad because in the story he claims to have full control of his mind and that he’s not mad just that most of his senses got enhanced. for instance The narrator says “IT’S TRUE! YES, I HAVE BEEN ILL, very ill. But why do you say that I have lost my mind, why do you say that I am mad? Can you not see that I have full control of my mind?” This quote Highlights that the narrator wasn’t mad at all and even seems confused when being accused of being angry. Another key point would be when the narrator states “Is it not clear that I am not mad? Indeed, the illness only made my mind, my feelings, my sences stronger, more powerful.” This quote reveals that he may have not been angry but he could have felt a different way possibly nervous. Overall this tells us that the narrator might have been someone who kept to himself.

please tell me how I can improve this segment of my writing thxs!!!!

please!

A few months ago when i was walking down the street i saw the crosswalks where wet with paint and some people walking around with paintbrushes, so i decided to see what was going on. They told me that they were doing sidewalk paintings, so i asked if i could join in and they said i could but i would have to put down some tape first. Once that was done i picked out a color and just did what i wanted to my 2 panels of sidewalk. When we were done for the day i got a really cool coupon for a craft store in appleton. I had a great time making friends and painting things for all to enjoy!

Answers

Answer:

At the beginning when you said a few months ago put the month to be more specific

Explanation:

(ELA) How is a claim different from an opinion?

A. An opinion requires more thought than a claim.

B. A claim is supported with reasons and/or evidence.

C. A claim is more like a story that makes a point.

D. An opinion is less believable than a claim.

Answers

Answer:

b

Explanation:

Answer:

B!!

Explanation:

0 00:00:00
Jettison folks 2007, Magnum opus, be moving, offers
poisoned commentary on the film industry. It's a honey
industry. The artificial boundaries we put up between
ourselves and those around us, as well as the true meaning
of friendship, romance, and following your dreams. The fact
that so few people recognize this germ for semester piece
that it is and for its contribution to the arts is truly a national
embarrassment. Many Benson is a young be faced with án
impossible decision. He has to pick his droppings of HIV and
he will work as a job every day until he dies. He simply
cannot further making sexual limiting choice, especially when
centers, a whole unexplored world out there builds a hive.
Burners struggle resonates with any recent high school and
college graduate who has decided what steps to take next.
This decision will affect the rest of their lives. But with so
many unexplored options, it feels impossible to only pick one
before looking himself into one occupation for the rest of his
life. Very ventures outside into the human world was elite​

Answers

Answer:

What's this I didn't understand it at all!?!?

3.
Which underlined word is a proper noun acting as an adjective?


Courts also provide
much-needed protection from illegal actions.

Sandra Day O’Connor is a retired Supreme Court judge.

The judges involved in court systems in the United States make decisions in disputes.

Our court system is based on English common law.

Answers

Answer:

none of them are underlined...?

Explanation:

1. Have you ever experience being unsatisfied with yourself? Why? Or why not?
2. which attitude or yours do you think that triggers you to be dissatisfied with yourself?
3. What made you realize to change it into a better one?
4. And how did you overcome your discrepancies in yourself.

Answers

Answer:

1, Yes being ignornant because itll get you no where. 2.Being ungrateful or greedy. 3. learned and taught myself

Explanation:

How does the conflict in the Animal Farm excerpt
relate to the events in the historical passage?
O Snowball's quick escape under the hedge is similar
to how Stalin was expelled.
O Snowball's ideas about work relate to the Stalin's
efforts to gain total control.
O Napoleon removes Snowball for his own purposes
just as Stalin removed those in his own party.
O Snowball's dream for the animals on the farm is the
same as the dream of the Communist Party.

Answers

Answer: Napoleon removes Snowball for his own purposes  just as Stalin removed those in his own party.

Explanation:

Animal Farm by George Orwell is an allegory to the events in the Soviet Union after the death of Lenin led to a power struggle between Trotsky and Stalin.

Napoleon and Snowball in the book have different views on how to proceed after they had seized the farm just like Stalin and Trotsky did after the death of Lenin. This led to Napoleon deceitfully getting rid of Snowball just as Stalin got rid of Trotsky.

In this poem, Walt Whitman writes about how Americans "sing" as they work. What does
he mean? Why does he think that work is like a song?

Answers

Answer:

The happiness of work. America is happy with working.

Explanation:

In "To My Old Master," what is Anderson's viewpoint of the
Colonel?
He doesn't bèlieve the Colonel is trustworthy, so he
asks to work for Henry or George Carter instead.
He doesn't believe the Colonel is trustworthy, so he
offers a test he knows the Colonel will fail.
He believes the Colonel is trustworthy and
appreciates the healthcare he provided.
He believes the Colonel is trustworthy and is grateful
for the clothing provided.

Answers

Answer:

He doesn't believe the Colonel is trustworthy, so he offers a test he knows he'll fail.

Explanation:

So, he was a former slave along with his wife before everyone was freed. His old "master" basically sent him a letter saying that he would pinky promise to treat him well, that he would be free, and that no one else would give him a better opportunity. At this point, he's earning decent money, has a fine life, and knows the Colonel is a not so great guy. He tells him he isn't mad about the Colonel trying to shoot him 2 times, or any of the other mistreatment, but he wants the Colonel to prove he's changed. He wants the $25 a month he should have been paid for working for him for 32 years, and the $2 a week his wife would have made in 20 years. It ends up being over $11,000 - which he knows the Colonel would never pay.

Also, come on guys - you're better than flooding this site in fake answers. Don't you have anything better to do with your time?

Given today's high temperature of 39 degrees Fahrenheit, find the degrees in Celsius
(F-32) 5/9
(39-32) 5/9
7 x 5/9 can be rewritten as 7/15/9
Remember we multiply numerator to numerator, and denominator to denominator
35/9 - 3.89 degrees Celsius
Your problem:
Given January 14, 2021 high temperature of 59 degrees Fahrenheit, find the degrees in
Celsius
(
F32) 5/9
(59 -32) x 5/9
...complete the problem to find the solution
3.89 Celsius
15 Celsius
1222 Celsius

Answers

Answer:

15 Celsius

Explanation:

The equation used to convert Fahrenheit to Celsius is as follows

[tex](F-32)\dfrac{5}{9}=C[/tex]

Here for my problem the temperature is [tex]59^{\circ}\text{F}[/tex]

[tex](59-32)\times \dfrac{5}{9}[/tex]

[tex]=27\times \dfrac{5}{9}[/tex]

[tex]=3\times 5[/tex]

[tex]=15^{\circ}\text{C}[/tex]

So, [tex]59^{\circ}\text{F}[/tex] is equal to [tex]15^{\circ}\text{C}[/tex].

Read the excerpt from midsummer by derek walcott Praise had blee my lines white of any more anger, and snow had inducted me into white fellowships, while Calibans howled down the barred streets of an empire Based on the allusion to Calibans, readers can infer that
the speaker
Obelieves most British people are prone to violence.
feels that the rioters are different than this
Shakespearean character.
Obelieves that the current anger in Brixton is justified.
feels that the rioters are similar to this
Shakespearean character.

Answers

Answer:

feels that the rioters are similar to this Shakespearean character.

Explanation:

I did the quiz

Based on the allusion to Calibans, readers can infer that the speaker feels that the rioters are similar to this Shakespearean character.

What is Allusion?

This is a figure of speech which talks about the person or character who is not present as if he were present without doing it overtly.

With this in mind, we can see that from the given narration, there is the use of allusion to show that there is the deduction that the speaker feels that the rioters are similar to this Shakespearean character.

Read more about allusion here:

https://brainly.com/question/2427003

Read the following passage and answer the question.

And though I have kept the name, I am not—for reasons you will soon discover—the same Charlotte Doyle.

Which themes does this passage suggest? Select all that apply.

transformation
love
justice
change

Answers

Answer:

transformation and change

Explanation:

"I am not—for reasons you will soon discover—the same Charlotte Doyle." suggests that the character has changed in a way to where they aren't the same.

Answer:

A. and D. Transformation and change

Explanation:

read the following sentence :"the massive hail beat against the front windows" in this sentence ,the word beat is a verb a noun an adjective an idiom​

Answers

Answer: verb

Explanation: a verb is a  word used to describe an action, state, or occurrence, and forming the main part of the predicate of a sentence, such as hear, become, happen.

plz help uve been stuck​

Answers

Answer:

List- Ideas as bullet points

Clustering- Main topic

Free writing- Write quickly

Answer:

Hi there~

The answer would be:

Freewriting : Write quickly without stopping or editing.

List : Write down bullet points.

Clustering : The main topic is in the middle circle and related ideas surround the main topic.

Hope this helps

Minisugarr

how were the boats that set sail thousands of years ago like modern spaceships ?

Answers

Answer:

they allowed people to travel places they couldn't before

Please answer this question

Answers

Answer:

Explanation:

Unhunhhnhumhhjh mhm unhimfgyhuyGjmhhgh)

(ELA) Which Hindu god became part elephant?

A. Ra
B. Krishna
C. Ganesha
D. Zeus

Answers

Answer:

I'm not super learned in the Hindu religion, but I'm pretty sure it's Ganesha

Answer:

C. Ganesha

Explanation:

Ganesha is the god of "luck" and success! And among the Hindus the elephant was an animal that brought good luck.

Glad if I helped!

Why is taking notes beneficial to a student?

Answers

Answer:

because you can look back at them and also you them to study

Explanation:

Which lines most fully support an interpretation that the speaker feels the nonpoets of the modern world have a misguided perspective?
А
Lines 11-12 ("And make ... door")
B
Lines 14-15 ("To grow...go-getter")
с
Line 24 ("No longer
dreams)
D
Line 33 ("A wordy ... problems")
E
Lines 38-39 ("Grow up
wants")

Answers

Answer:

Explanation:it is D

Answer:

Lines 38-39 (“Grow up . . . wants”)

Explanation:

Correct. The speaker’s advice to “Grow up and join the big, busy crowd / That scrambles for what it thinks it wants” (lines 38-39) follows his advice that “this is no time nor place for a poet” (line 37). By putting the crowd in opposition to poets and saying it “scrambles for what it thinks it wants” (line 39), the speaker implies that the nonpoets are undignified and misguided in their desires.

Add the missing root word below.

The root word for emulate is__.

Answers

Answer:

Latin term for rivaling or envious.

Explanation:

Latin term for rivaling or envious.

Answer: Aim

I'm not too sure if this is the correct answer but I hope it can help

What challenges does Captain Bunk face in the story

Answers

Answer:

story please

Explanation:

provide tye story whit this question please

The City Mouse and the Country Mouse

A City Mouse and a Country Mouse were acquaintances (friends), and the Country Mouse one day invited his friend to come and see him at his home in the fields. The City Mouse came, and they sat down to a dinner of roots. The fare was not much to the taste of the guest, and presently he broke out with "My poor dear friend, you live here no better than the ants. Now, you should just see how I fare (live)! You must come and stay with me, and I promise you, you shall live on the fat of the land." So when he returned to the city he took the Country Mouse with him, and showed him into a pantry containing flour and oatmeal and figs and honey and dates. The Country Mouse had never seen anything like it, and sat down to enjoy the luxuries his friend provided: but before they had well begun, the door of the larder opened and someone came in. The two Mice scampered off and hid themselves in a narrow and exceedingly uncomfortable hole. Presently, when all was quiet, they ventured out again; but someone else came in, and off they scuttled again. This was too much for the visitor. "Good-bye," said he, "I'm off. You live in the lap of luxury, I can see, but you are surrounded by dangers; whereas at home I can enjoy my simple dinner of roots and corn in peace."

WILL MARK BRAINILIST
Which of the following most closely reflects the theme of the passage? (10 points)

A modest life with peace and quiet is better than a richly one with danger and strife.
Precious things are for those that can prize them.
Just because something is difficult does not mean it is bad.
Do not be deceived by the innocent looks of those that were once your enemies.

Answers

Answer: A (the first one)

Explanation: I think that it is the first one because when the city mouse brings the country mouse to his home in the city, the text explains how it's a luxurious place with with lots of food, but it's also very dangerous. Also, when the country mouse leaves, he says that the city mouse might have a luxurious house, but his house in the fields is more peaceful and less dangerous. :)

Which statement from paragraph 4 is an example of evidentiary support?

Answers

Wheres paragraph 4 my guy??

C. Fill in each blank with the appropriate adjectives given in the box.
afraid tall
nice
green
best
dark glad cheap
elder
intelligent
lovely shiny riding dirty romantic
1. That is the ...
thing we want.
2. I like her ... ... eyes.
3. The .....
boys are clever.
4. They are not
5. The child is
6. She was
7. I like ... ..... colour.
8.
He is very ...
9. She has got a.
... child.
10. This book is
11. She has .............. hair.
12. I hate
things.
13. I like ..... films.
14. My ....
sister is a teacher.
15. He has lost his ..... .... boots.​

Answers

Answer:

best

green

Explanation:

gjjdh he gggj

Read the excerpt from “Tools of the Spymaster." General Gates's troops held their ground. Benedict Arnold, one of Gates's generals, argued for a counterattack that would smash the British force. Gates, outraged that Arnold would challenge his order, took away his command. But the rash Arnold saw a chance to strike a crucial blow. He galloped through the crossfire of both armies, inspiring his men. A bullet struck his leg, but he rode on, leading the final assault that shattered the British fortifications. If he had died of his wounds that day, Arnold would be remembered as one of the great heroes of the Revolutionary War. What evidence in the excerpt suggests that Benedict Arnold was a brave soldier? He did not die from his wounds in the battle. General Gates took away his command. A bullet struck his leg when he crossed the battlefield. He galloped through the crossfire of both armies.

Answers

Answer:

The answer is D.

Explanation:

I would be fricking scared to ride a horse thru gunfire

Answer:

Explanation:

d

Other Questions
pls someone plsss help meeeee There once was a ship that put to seaThe name of the ship was the Billy of TeaThe winds blew up, her bow dipped downO blow, my bully boys, blowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goShe had not been two weeks from shoreWhen down on her a right whale boreThe captain called all hands and sworeHe'd take that whale in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goBefore the boat had hit the waterThe whale's tail came up and caught herAll hands to the side, harpooned and fought herWhen she dived down lowSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goNo line was cut, no whale was freedThe Captain's mind was not of greedAnd he belonged to the whaleman's creedShe took that ship in towSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goFor forty days, or even moreThe line went slack, then tight once moreAll boats were lost, there were only fourBut still that whale did goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goAs far as I've heard, the fight's still onThe line's not cut and the whale's not goneThe Wellerman makes his regular callTo encourage the Captain, crew, and allSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and goSoon may the Wellerman comeTo bring us sugar and tea and rumOne day, when the tonguin' is doneWe'll take our leave and go Please help Im stuck!!!! PLEASE HELP I NEED THE ANSWER QUICK!!! What is the Length/ value of N is 63 / 168 equivalent to 312 / 832 Which Pope wanted to liberate Jerusalem from Muslim control? A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior? tell whether each question is true or false.a. [tex] \sqrt[3]{60} = 20 \: true \: or \: false[/tex]b.[tex] \sqrt[3]{64} = \sqrt{16 \:} true \: or \: false[/tex]c. [tex]25 = \sqrt[3]{125} \: true \: or \: false[/tex]d.[tex]12 = \sqrt[]{144} \: true \: or \: false[/tex]e.[tex] \sqrt{ \frac{4}{9} } = \sqrt[ 3]{ \frac{8}{27} } \: true \: or \: false[/tex] If a wagon train traveled 12.5 miles each day, how many days would it takethem to get to Independence Rock which is 900 miles from their startingpoint?