Practice Pages 69&70

Answers

Answer 1

Answer:

Yes, Teacher

Step-by-step explanation


Related Questions

Twelve minutes after he starts downloading a file, Mario looks at his computer and sees this image. About how long will it take to download the entire file?

Answers

File = f. Imagen complete = i
f + 12 = i

Find the slope of line that passes through the points ( 0,5) and ( 2,2)

Answers

Answer:

m= -3/2

Step-by-step explanation:

Solve the inequality and enter your solution as an inequality comparing a variable to a number x+9>13

Answers

Answer:

x>4

Step-by-step explanation:

Step 1: Subtract 9 from both sides.

x+9−9>13−9

x>4

What do I have to multiply 5/6 by to get an equivalent fraction

Answers

Times 5 because that’s will be 30/30

Answer:

you multiply 5/6 5 times to git 4

Step-by-step explanation:

Raphael purchases a new DVD at M-Mart. He
pays 8% in tax on the cost of the DVD. If the tax
amount is $1.20, how much does Raphael
spend on the DVD, including tax?

Answers

Answer:

The amount Raphael spend on DVD including tax is $16.2

Step-by-step explanation:

Tax on DVD = 8%

Amount of tax = $1.20

We need to find the amount Raphael spend on DVD including tax.

Let the cost of DVD = x

We can write the equation: [tex]8\%\:of\:x=1.20[/tex]

Because the tax amount is 8% of actual cost and is equal to 1.20

Now solving to find x:

[tex]8\%\:of\:x=1.20\\8\%\times\:x=1.20\\\frac{8}{100}\times x=1.20 \\x=1.20 \times \frac{100}{8}\\x= 15[/tex]

So, the cost of DVD = $15

Now, The amount Raphael spend on DVD including tax = Cost of DVD + Tax

The amount Raphael spend on DVD including tax = 15 + 1.2

                                                                                    = 16.2

So, The amount Raphael spend on DVD including tax is $16.2

Simplify: 3x + 4y + 7x - 2y

Answers

Answer:

10x+2y

Step-by-step explanation:

combine like terms

Answer:

Step-by-step explanation:

3x + 4y + 7x - 2y=3x + 7x +4y - 2y

10x + 2y

6. A bicycle store costs $2200 per month to operate. The store pays an average of $60
per bike. The average selling price of each bicycle is $80. How many bicycles must the
store sell each month to break even?

Answers

they would need to sell at least 27 bikes

The library has 65400 art books and 9600 science books. What part of all the books are science books

Answers

Answer:

9,600/75,000, 16/125

Step-by-step explanation:

art+science=75000

9600

75000    =16/125

The part of all the books that are science books is 0.128 or 16/125.

Using this formula

Science books=Science books(Art books+Science books)

Where:

Science books=9600

Art books=65400

Let plug in the formula

Science books=9600/(65400+9600)

Science books=9600/75000

Science books=0.128 or 16/125

Inconclusion the part of all the books that are science books is 0.128 or 16/125.

Learn more about part of books that are science here:https://brainly.com/question/8513862

what is
2 1
_ + _ =
5 4

Answers

Answer:

3       1

–  = ——

9       3

Step-by-step explanation:

I simplified it as well.

ABCD is a parallelogram with coordinates A(4, 2), B(3, −1), C(−1, −1), and D(−1, 2). To prove that ABCD is a parallelogram, you would find which of the following?
A measures of the angles
B slopes of the diagonals
C lengths of the diagonals
D slopes of the sides

Answers

The answer is A im pretty sure

What are the order of operations

Answers

Answer:

PEMDAS

Step-by-step explanation:

1) Parentheses

2) exponents

3) multiplication

4) division

5) addition

and finally 6) subtraction

PEMDAS
Parentheses
Exponents
Multiplication or division (do left to right)
Addition or subtraction (left to right)

Or BIDMAS which is
Brackets
Indices
Division and multiplication
Addition and subtraction
Good luck!

CAN SOMEONE PLEASE HELP ME !!

Answers

With what number? With all? And why 5. It’s small for this difficult task.

Gwen borrows $300 from her parents to buy a bike. She agrees to pay them back with 3% simple interest every month for one year. What is the total amount of money Gwen will owe her parents? *
Just enter the numerical portion of your answer - no dollar signs or change needed!

Answers

Answer:

309.12

Step-by-step explanation:

A = total amount

P = principal

r = interest rate

n = number of times interest is compounded

t = time (in years

A = P(1 + [tex]\frac{r}{n}[/tex])^nt

A = 300(1 + [tex]\frac{.03}{12}[/tex])^12 · 1

A = 300(1.0304)

A = 309.12

Answer:

408

Step-by-step explanation:

To rent a certain meeting room, a college charges a reservation fee of $34 and an additional fee of $9.30 per hour. The math club wants to spend less than $99.10 on renting the meeting room.
What are the possible amounts of time for which they could rent the meeting room?
Use t for the number of hours the meeting room is rented, and solve your inequality for t.

Answers

Answer:

9 hours.

Step-by-step explanation:

31 + 5.9*t < 84.10.

To solve it, collect the constant terms on the right side:

5.9*t < 84.10 - 31 = 53.10,

Hence, t < 53.10%2F5.9 = 9 hours.

Answer:

7 hours

Step-by-step explanation:

99.10-34=65.1

65.1 divide by 9.30=7

Hope this helps!!

For triangles Y Z X and C D B, sides Y Z, Z X, C D, and B D are 2.5 centimeters. Sides B C and Y X are 3.8 centimeters. Angles B, C, Y, X are 36 degrees. Angles Z and D are 108 degrees.
Which of the following congruency statements is correct?
ΔYZX ≅ ΔBCD
ΔYZX ≅ ΔDCB
ΔZXY ≅ ΔDCB
ΔYXZ ≅ ΔCDB

Answers

Answer:

the answer is C

Step-by-step explanation:

edge 2021

Answer:

ΔZXY ≅ ΔDCB

Step-by-step explanation:

4.
One-third of Olivia's age, increased by 12, is equal to twice her age, decreased by 3. How old is Olivia?

Answers

Answer:

19?

Step-by-step explanation:

maybe i got it right

Simplify 4 1/3 times 4 1/5

Answers

Answer:

Exact Form:

91 / 5

Decimal Form:

18.2

Mixed Number Form:

18 1/5

please help its algebra 1

Answers

Answer: She can take 25 students.

Step-by-step explanation:

If she has 150 dollars and the bus costs 100, and she only charges 2 dollars each, then 50 divided by 2 equals 25

Answer:

I think 25 students

Step-by-step explanation:

Her budget is $150 .She is already paying $100 for the bus so you have $50 dollars now.If each student is charged $2 all you have to do is divide $50 by 2 and that gets you 25.So 25 students.Hope this helped =)

A baker made 9 cupcakes, each a different type. Four people want to share them equally. How many cupcakes will each person get? DIvide and use in fraction form.

Answers

Answer: 2 1/4

Step-by-step explanation:

From the question, we are informed that a baker made 9 cupcakes which are to be shared equally by four people.

To get the number of cupcakes that each person gets, we divide the total number of cupcakes by the total number of people. This would be:

= 9 ÷ 4

= 2 1/4 cupcakes

Therefore, each person gets 2 1/4 cupcakes.

A number cube is rolled 360 times and the results are recorded as follows: 52 ones, 59 twos, 67 threes, 73 fours, 42 fives, and 67 sixes. What is the experimental probability of rolling a two or a three?

Answers

Answer:

0.35

Step-by-step explanation:

Total rolled = 360 times

Two rolled = 59

Three rolled = 67

Two rolled probability = 59/360 = 0.164

Three rolled probability = 67/360 = 0.186

The experimental probability of rolling a two or a three

==> Two rolled probability + Three rolled probability

==> 0.164 + 0.186

==> 0.35

Standard Form: 3x+4y=−16

Answers

Answer:

i know the answer

Step-by-step explanation:

Plzzz someone help meeee!!!! :(

Answers

Answer:

5 feet

Step-by-step explanation:

The rose garden is trianglar and so the total of the two shorter sides need to equal more than the longest side. In this case 4+x=9. 6,7, and 8 all meet these requirments but 4+5 is 9, 9=9 which means 5 feet cannot be used

Would the answer be 8?

Answers

Answer:

Step-by-step explanation:

yes i think so because from point d to point s it’s 4 and then from a to l it’s the same length so i do think it would be 8. 4+4 is 8

If f(n)= n2. n, then f(-4) is?

Answers

Answer:

f(-4) = 16

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Algebra I

Function Notation

Step-by-step explanation:

Step 1: Define

f(n) = n²

f(-4) is n = -4

Step 2: Evaluate

Substitute:                    f(-4) = (-4)²Exponents:                   f(-4) = 16


2 + (-10) =
HELP ME PLEASE T^T

Answers

Answer:

The answer would be 8

Step-by-step explanation:

This equals 10-2=8

Answer:

-8

Step-by-step explanation:

If you subtract 10 from 2 you get 8 and since the negative number is greater than the positive number it would be -8

I need help with A and B

Answers

Answer:

a cube and a square-faced pyramid

Half the area of the rectangle shown is 24 inches. Write and solve an equation to find the value of 'x'

Answers

Answer:

The answer will b 4

Step-by-step explanation:

Answer:

12

Step-by-step explanation:

2. A pair of Jordans sold at retail for $180 and now sell for $330 after market.
A. Is this a percent INCREASE or DECREASE?
B. What is the PERCENT change?

Answers

Answer:

Um increase and the percentage change is 150

Step-by-step explanation:

my classmate is unsure about how to use side lengths to determine the type of triangle. How would i explain this to my classmate

Answers

equilateral triangles are made of all even sides with a angle of 60 degrees

isosceles triangle has two of the same sides and ond different side

scalene triangles have all different sides

brainiest please

M<2=x+88 can you please tell me the answer for this

Answers

Answer:

Answer: A) -8

Step-by-step explanation:

The image shows the triangle where it can be noted that two of its sides are congruent (according to the tick marks). This forms an isosceles triangle that also has two congruent angles as shown in the image below.

The other angle (2) has a measure of x+88.

The sum of the internal angles of the triangle must be 180°, thus:

x + 88 + 50 + 50 = 180

Simplifying:

x + 188 = 180

x = 180 - 188 = -8

x = -8

Answer: A) -8

Other Questions
A 14.0 tank contains 250 g of methane (CH4) gas at 27 atm at 298 K. Accidentally, 190 g of CO2 was added to the tank. What will be the resulting pressure of the mixture in the tank? Assume that no CH4 leaked out as the CO2 gas waa being added. Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) PLEASE HELP!! I'LL GIVE BRAINLEST!!Use the formula P = 2l + 2w. Find the perimeter of a rectangle with a length of 12.9 ft and a width of 19.3 ft. Show all of your work. (4) NH3+02- NO+H2Obalance the equation Find the slope intercept equation of the line Ryan buys a baseball bat. The original price is $20. Ryan has a coupon for a 20% discount. What is the sale price? Which can provide the most energy in an ecosystem?a mushroom ,a coyote, a pine tree ,a grassy meadow Please HELP what is the slope-intercept equation slope: -2 y-intercept: 3 Please help me with this question please!!!Look at the picture provided and answer the question >>Select one only.Q:An aromatic hydrocarbon is represented by which structural formula?>>Choose one answer from the picture below that answers the question above ABCD Angel and his 2 sisters shared 1/2 cup of baby carrots. How many cups did they each get? How does biology affect behavior? tell whether each question is true or false.a. [tex] \sqrt[3]{60} = 20 \: true \: or \: false[/tex]b.[tex] \sqrt[3]{64} = \sqrt{16 \:} true \: or \: false[/tex]c. [tex]25 = \sqrt[3]{125} \: true \: or \: false[/tex]d.[tex]12 = \sqrt[]{144} \: true \: or \: false[/tex]e.[tex] \sqrt{ \frac{4}{9} } = \sqrt[ 3]{ \frac{8}{27} } \: true \: or \: false[/tex] If a wagon train traveled 12.5 miles each day, how many days would it takethem to get to Independence Rock which is 900 miles from their startingpoint? Find the value of c x 8 when c=9. Can someone find the mistakes and make the sentence plz.On both plz :( Which sentence uses parallel structure correctly?A) We plan on playing basketball and then to see a movie.B) She is not only a good cook but also she figure skates well.C) At the last performance, we were all feeling sad, relieved, and being somewhat nervous.D) Len's favorite pastimes are listening to music, going to baseball games, and hanging out with his friends. Put this in your own words, I'm writing a informational essay, will give brainiest.In addition, if there's someone encouraging another person, there being courageous. 19. The teaching of standards andexpectations of a particular culture iscalledA. discipline.B. guidance.C. limiting.D. constructing. In the first eight days after its release, how many Nintendo Wii systems were sold? Solve for xPLS HURRY