Answer: They are all formed from the same elements.
Answer: the answer is c
Explanation:
question one : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other
question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other
question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age
Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?
Answer:
Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of the process of cellular respiration. And what happens to the other 66% is that it's used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat
Explanation:
are bones living or non living and why
Answer:
i think they are non living
Explanation:
because they dont have organs or blood or anything
Answer:
Bones are non living
Explanation:
1: Bones don’t movement on their own
2: Bones don’t have cells
3: Bones do bot breathe
4: They do not count on anything to survive
5: They are just something that helps a living organism to move
What is H₂O - H₂+ boz
Answer:
-tH2
H20 - H2 + boz
0-H2t
-tH2
Explain how one celled organisms get oxygen in water.
Answer:
n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.
Explanation:
What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.
Answer:
Cells reproduce without limit. Cells reproduce with multiple cells
A substance only composed of one kind of atom is a(n) *
ASAPPPP!!!!
Write step by step instructions for making a protein
What components are needed for
photosynthesis?
Answer:
sunlight, carbon dioxide, and water as substrates
Explanation:
Hope this helps :]
Answer:
Explanation:
chicken leg piece and/Photosynthesis is a multi-step process that requires sunlight, carbon dioxide, and water as substrates. It produces oxygen and glyceraldehyde-3-phosphate (G3P or GA3P), simple carbohydrate molecules that are high in energy and can subsequently be converted into glucose, sucrose, or other sugar molecules.
In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion
Answer:
Facts that is right
Explanation:
In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion
The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.
These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion
Learn more about:
https://brainly.com/question/7135096
Please Help me as soon as possible.
In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.
Answer:
The answer is; c
It is important to distinguish between codominance and incomplete dominance.
In incomplete dominance, the two alleles blend with each other in phenotype giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.
In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.
Explanation:
what is the percentage of thymine in wheat ?
Answer:
27.1% or 27% if rounded
Explanation:
Hope this helps ya!!
Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?
Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?
Answer:
Wedging (for the first one)
Explanation:
Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an animal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.
Answer:
A handler must know an animal’s pattern of movement in order to avoid injury.
Explanation:
Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.
Answer:
A
Explanation:
i got it wrong and it showed the correct answer
The law of___________explains how traits are inherited through generations.
Answer:
the law of inheritance
4) How does climate affect ecosystems and the life within them?
Answer:
Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.
When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)
Answer:
Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.
Explanation:
So its A
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answer:
u want step by step?
Explanation:
fill in the complementary bases according to the base-pair rule.
a | t | c | c | g | a | t | a | g | c | t | t | a | g
100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content
Answer:
B
Explanation:
YOOOOOOOOOOOOOOOOOOOOOO
ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?
Give two examples of why water is important to the human body.
Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.
Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid
Answer:
Lipid is the most likely answer.
What would be the temperature at a depth of 2500 km?
Answer:
4700 Degrees Celsius
Explanation:
A water molecule is attracted to another water molecule. This is an example of
What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?
Give two examples each of centripetal force
Answer:
Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.
Explanation:
hurry due in five min plz help
Answer:
b
Explanation:
Answer:
d
Explanation:
I hope that helped!
WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:
glycogen is to glucose.
testosterone is to a steroid hormone.
a phospholipid is to a plasma membrane.
a nucleotide is to a nucleic acid.
Using the diagram below, how many electrons will Be have if it is a neutral atom?