Question 4
1 points)
A scientist warms a chemical to 385 K, and the chemical begins to boil. How much higher is this boiling point of the chemical
than the boiling point of water?

Answers

Answer 1

12K is the boiling point of the chemical .

The boiling point of any liquid changes to the applied pressure the normal boiling point is the temperature at which the vapor pressure is equal to the standard sea-level atmospheric pressure .At sea level, water boils at 100° C (212° F).The boiling point of a liquid is the temperature at which its vapor pressure is equivalent to the pressure of the gas above it.

Boiling point is used to identify and classify a given compound. A liquid boils when its vapour pressure is equal to the atmospheric pressure. Vapour pressure is also defined  by the kinetic energy of a molecule. Kinetic energy is dependent on the temperature, mass and velocity of a molecule.

To learn more about vapour pressure , here

brainly.com/question/25699778

#SPJ1


Related Questions

someone Please help!! I'm not good at this stuff. I'll give brailniest

Answers

Answer:

What do you need help with?

Explanation:

describe some of destructive action of microbes ​

Answers

Answer:

A microbe is a small living thing too tiny to be seen by the naked eye and includes bacteria, fungi and viruses. Among their destructive actions is causing diseases in human beings and their livestock or plants, destruction of food by causing decomposition which might lead to hunger and other related calamities. Despite this destructive consequences, microbes are also known to have advantageous actions like helping in sewerage treatment, microbes found in the gastro-intestinal tract help in maintaining a good environment for digestion to take place. Microbes also help in ecological balance by causing decomposition of dead matter hence conserve the environment.

Explanation:

Answer:

see the attached photo

(HELP WANTED AUTOMATIC BRAINLY) Which statement describes how the muscular and skeletal systems cause parts of the body to move?
A. When a muscle relaxes, it causes a bone to shorten.
B. When a bone shortens, it lengthens the muscle attached to it.
C. When a bone bends, it pushes a muscle in the opposite direction.
D. When a muscle contracts, it pulls a bone in one direction.

Answers

Answer:

C.

Explanation: Because when a bone does bend the muscles pull back so the bone doesnt dislocate.

The statement describes how the muscular and skeletal systems cause parts of the body to move is when a muscle contracts, it pulls a bone in one direction.

What is skeletal system?

The skeletal system is the in charge of all the bones and skeleton of the body. The skeletal system provides structure and strength to the body and protects the soft tissues.

The muscular system and the skeletal system work together as the muscles and bones are connected with each other.

Thus, the correct option is D. When a muscle contracts, it pulls a bone in one direction.

Learn more about the skeletal system, here:

https://brainly.com/question/1283837

#SPJ5

Which one is it I need help?

Answers

answer a is correct

The last universal common ancestor (LUCA) probably multiplied by duplicating all of its cellular contents, followed by cellular division .

Answers

Answer: true

Explanation:

i guessed and got it right

Which American Indian group was allied with the British as the French and Indian War began?
A)the Huron
B)the Ottawa
C)the Iroquois Confederacy
D)the Algonquin

Answers

Answer:

The Iroquois Confederacy would be your answer.

hope it helps!

PLZ HELP (30 POINTS)




Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing?

Reducing soil degradation
Inventing new fertilizers
Updating irrigation
Increasing climate change

Answers

Answer: The answer is D Increasing climate change

Explanation: Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing? hope this helps man

D

Explanation:

i think that's the answer

Why are online banks becoming more popular?

Answers

Answer:

Online banks are becoming more popular because people don't want to get out of there house and also because of the virus

Explanation:

Hope this helps an also can I have a brainliest

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

2. Tell the difference between the following
- Llittoral zone/limnetic zone
- photic/aphotic zone
- lake/wetland
- freshwater marsh/swamp/bog
- intertidal/neritic/open ocean zone

Answers

Answer:

1. littoral zone is a zone where lives continue after dead.

2. Photic zone is the zone where light Ray's give out to all plants.

2b. aphotic zone is a zone below where light absent.

3. Lake/wetland is a part of land where water is cover or absolutely moist in it nature.

Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.

Answers

Answer:

The correct answer would be - low flower density and low deep flower proportion

Explanation:

To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.

To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.

Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.

This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.

How do flower visitors diverse the traits?

It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.

The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.

In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.

Therefore, the correct answer is low flower density and low deep flower proportion.

Learn more about the flower density here:

https://brainly.com/question/11253692

Please I will do anything BRAINLIEST 20 POINTS

Answers

Answer:

question 2 is newtons first  law

Explanation:

11. Peripheral membranes are located

Answers

Answer:free point

Explanation:

The answer for the question is free point

An ideal frictionless machine: O has very little friction O has no friction does not require work input PLEASE HELPP MEEE ​

Answers

Answer:

Has very little friction

Explanation:

If there isn't enough friction stuff can get out of control, but just a little is just right.

Answer:

has no friction

Explanation:

got this correct in my work

What traits might transfer across generations within animal species?

Answers

biological fitness or darwinian fitness there the same thing

Which of the following problems are a result of acid deposition?


Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only

Answers

Answer:

II and III

Explanation:

Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.

Hope this helped!

Describe how energy flows through an energy pyramid? Write your answer in the space provided below.

Answers

Answer:

Depending on the food pyramid, on the side there may be something that says decomposers. These eat from all of the sections of the pyramid.

Energy flows from the bottom to the top, and then to the side with the decomposer.

describe one piece of evidence represented by the contour line on the map that indicates the north side of chimney bluffs is steep?

Answers

Incomplete question. Attached is the image of the map below.

Explanation:

From the map, we could notice the contour lines around the Chimney Bluff areas are closely packed together. In other words, the spacing between the contour lines is narrower than those found in other locations.

This assertion is accurate because it is a standard practice in many maps to indicate the steepness of an area by having the contour lines in close proximity.

What are the two categories that Igneous Rocks can be classified into?
How do you tell them apart?

Answers

Igneous rocks are divided into two groups, which penetrate or expand, depending on the strength of the molten rock.

Intrusive Igneous Rocks: Intrusive, or plutonic, is an empty rock that occurs when magma is trapped in the depths of the Earth.Extrusive, or volcanic, igneous rock is produced when magma exits and cools above the Earth's surface.

hope it helps!

which factor would increase the production of glucose by photosynthesis

Please help!!!

Answers

Answer:

freezing temperatures

The amount of sun it’s getting

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Which are different forms of the same gene?
A.genotypes
B.phenotypes
C.alleles
D.traits

Answers

Answer:

alleles

Explanation:

An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.

Answer:

C. alleles

Explanation:

edge 2021

Help me ASAP please

Answers

Answer:

C

Explanation:

How is the DNA code itself a homology?

Answers

Answer:

Explanation:

These fundamental similarities are most easily explained by evolutionary theory: life shares a common ancestor. ... In fact, the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Answer:

the DNA code itself is a homology that links all life on Earth to a common ancestor. DNA and RNA possess a simple four-base code that provides the recipe for all living things.

Which is the outcome of a mass of cells in the lungs?

A. The lungs will stop working.
B. This will not affect the lungs.
C. The lung's capacity for oxygen will be positively affected.
D. The lung's capacity for oxygen will be negatively affected.

Answers

D. The lung's capacity for oxygen will be negatively affected.

The lung has a capacity of a about 5L this will decrease becuase the mass will obstruct the airway.

Answer:

D. The lung's capacity for oxygen will be negatively affected.

Explanation:


Which type of energy
does respiration release?
chemical
thermal
potential
kinetic

Answers

Answer:

Respiration releases energy it is an exothermic process. The energy is stored in molecules of ATP . ATP can be broken down in other processes in cells to release the stored energy.

chemical

According to the graph below, at which point is the plant preforming the most photosynthesis?

A. Point D.
B. Point B.
C. Point C.
D. Point A.

Answers

Answer: C

Explanation:

Point c would be the answer to your question

Joseph and Molly each have coin collections. Joseph starts with 15 coins in his collection and adds 25 coins each month. Molly starts with 25 coins in her collection and adds 25 coins each month. If Joseph and Molly continue to collect in this way, how many coins will each person have after 10 months? Enter your answers in the boxes. After 10 months, Joseph will have coins in his collection, and Molly will have coins in her collection.

Answers

Answer:

Joseph will have 265 coins and Molly will have 275 coins after ten months.

Explanation:

Joseph already has 15 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]15+25\times 10=265[/tex] coins.

Molly already has 25 coins and adds 25 coins after each month. So after ten months the total number of coins Joseph will have is [tex]25+25\times 10=275[/tex] coins.

So, Joseph will have 265 coins and Molly will have 275 coins after ten months.

Which process is best illustrated by the diagram?

Answers

Answer:

Photosynthesis

Explanation:

The formula shown is the one for photosynthesis.  6CO2 + 6H2O → C6H12O6 + 6O2. (please tell me if i am correct) :)

can all organisms respond to stimuli?

Answers

Answer:

I believe all living organisms can

Explanation:

Yes, all living organisms are able to respond to stimuli in their environment (stimuli= temps, gravity, and lighting)

Other Questions
Determine the product of 2.54 and 6.3 Amy said 49 of her teammates got hits during a recent softball game. Which decimal represents this same amount?A.0.49B.0.444C.0.444D.0.49 qin shi huang united china by:A)shutting down the popular silk roadB) giving government jobs to members of rich familliesC) awarding government positions based on meritD) replacing strict laws with less harsh lawshurry pleaseright answer gets brainliest 45% of 40 is what number What nation of the Three Kingdom period were Maebyeong bottles from? Describe how Maebyeong bottles were madeby Korean potters and the artistic elements of the bottles. The term performance quality refers to: Multiple Choice Customer satisfaction with the total experience of a product or service. The gap between product design specifications and actual performance of the product. The gap between actual performance of a product and customer expectations. Costs related to meeting customer demands and quality-related expectations. The difference between customer expectations (for attributes, services, functionality, etc.) and product design. can young people be taught so well that so well that they never question their teachings later? Pls help I just need the answer The sides of a square field are 28 meters. A sprinkler in the center of the field sprays a circular area with a diameter that corresponds to a side of the field. How much of the field is not reached by the sprinkler? Round your answer to the nearest hundredth. Use 3.14 for . Russia was not invited to the U.S.-sponsored Washington Naval Conference in 1921 because it did not have a navy i need help !! asap please !!! Why did the Supreme Court find Miranda's conviction unconstitutional? Can someone explain Slope to me? I literally have no idea what is from my teacher or from Aleks. I don't get what y1 and y2 are and i don't get what rise or run is. I have no idea how to get slope (brainliest for whoever explains a function too) SPAM WILL BE REPORTED SO PLEASE JUST DONT WAIST MINE, AND OTHER PEOPLE'S TIMESimple Question:Find the remainder when dividing (6x3 + 5x - 8) by (x + 2). A digital computer has a memory unit with 26 bits per word. The instruction set consists of756 different operations. All instructions have an operation code part (opcode) and anaddress part (allowing for only one address). Each instruction is stored in one word ofmemory. judicial review definition IN YOUR OWN WORDS Help me please ( ) Which historical document established a strong tradition of colonial self-government?A.Magna CartaB.ConstitutionC.English Bill of RightsD.Mayflower Compact if u can guess my number between 1-5 I will give brainliest :) What is the solution to the system of linear equations graphed below?Will give BRAINLEST