Reflection/Math please help

Reflection/Math Please Help

Answers

Answer 1

Answer:

Step-by-step explanation:

A' = (-4, 1)

B' = (-7, 2)

C' = (-2, 8)

D' = (-2, 3)

Answer 2
what the other guy said

Related Questions

Ross has a model truck. It has a scale of 1 inch for every 32 inches on a real-sized truck. He wants to build a garage for the model at the same scale.

Given that the garage for a real-sized truck is 12 feet wide, how wide should his model garage be?

Answers

Answer in decimal form:  4.5 inches

Answer as a mixed number = 4 & 1/2 inches

========================================================

Explanation:

" It has a scale of 1 inch for every 32 inches on a real-sized truck" means the the scale is 1:32

Put another way, the real life width is 32 times greater than the scale model.

So we can form the equation

y = 32x

where x is the scale model width and y is the actual real life width.

---------

The garage in the real world is 12 feet wide, or 12*12 = 144 inches wide.

Plug y = 144 into the equation and solve for x

y = 32x

32x = y

32x = 144

x = 144/32

x = 4.5

His scale model garage must be 4.5 inches wide

4.5 inches = 4 & 1/2 inches = 4 and a half inches

Answer:

4.5 inches

Step-by-step explanation:

First, convert all measurements to the mase units

12 feet  ->  144 in

Now, we will identify what 144 inches would be as a model scale. We will do so by dividing 144/32 since 32inches equals 1 model scale inch.

144/32= 4.5

therefore, the garage will be 4.5 inches as a model scale.

He was a newcomer in the land, a chechaquo, and this was his first winter. The trouble with him was that he was without imagination. He was quick and alert in the things of life, but only in the things, and not in the significances.



What do you believe the author is trying to explain and tell the reader?

Tip: Think about what the author is wanting you to understand with the underlined sections. Fully develop your thoughts to answer this question.

Answers

Answer:

TBH I'm kind of confused  on what you are being taught

Step-by-step explanation:

?????????

Today, everything at a store is on sale. The store offers a 20% discount.

a) The regular price of a T-shirt is $18. What is the discount price?

b) If the regular price of an item is dollars, what is the discount price in dollars? Write an expression.

c) The discount price of a hat is $18. What is the regular price?

Answers

Answer:

a. $14.4

b. $18 • .2 = $3.6

c. $21.6

Step-by-step explanation:

a. Make the 20% a decimal, and multiply by the regular price. Then, subtract that and you'll get the discounted price.

18 • .2 = 3.6

18-3.6 = $14.4

b. Use the equation multiplying the 20% as a fraction here.

c. Multiply $18 by .2 (the discount). Then, add that to the discount price ($18).

18 • .2 = 3.6

3.6 + 18 = $21.6

Create a proportion using the form = to represent the following word problem.

15 is 1 [tex]\frac{1}{2}[/tex] % of what number?

Answers

It’s 7 because 15 divided by 2, half is 7.5 then u get 7

Look at the attached image to see the question.

Answers

30, 6, 2, 1/2, 20, 12, 12, 3/5

plz i will give you brainlyest and 5 stars ues the distributive property to simplify the following expreshon
-2(x+3)

Answers

Answer:

-2x-6

Step-by-step explanation:

-2 multiplied by x = -2x

-2 multiplied by 3 = -6

I will give brainlest for the right answer. Please don't just make up a random thing. PLEASE!
Which expression is equivalent to 30(1/2x-2)+40(3/4y-4)?
45xy-220
15x-30y-220
15x+30y-220
15x+30y-64

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]30( \frac{1}{2} x - 2) + 40( \frac{3}{4} y - 4) = \\ [/tex]

[tex](30 \times \frac{1}{2} x) -( 30 \times 2 )+ (40 \times \frac{3}{4} y )- (40 \times 4 )= \\ [/tex]

[tex]15x - 60 + 30y - 160 = \\ [/tex]

[tex]15x + 30y - 220[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

The correct answer is Option Three .

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Abby takes a ride-sharing service to ride from her home to the mall. The ride-sharing service charges $1.75 per mile plus a one-time charge of $5.00.

Which equation can be used to find y, the total cost of the ride, given x represents the number of miles of the ride?

(A.) y=1.75x−5
(B.) y=1.75(x+5)
(C.) y = 1.75x + 5
(D.) y = 5x + 1.75

Answers

Answer:

c)

Step-by-step explanation:

$5.00 is a one time charge but $1.75 is per mile and x represents the number of miles.

The equation can be used to find y is option (C.) y = 1.75x + 5

Given that,

The ride-sharing service charges $1.75 per mile plus a one-time charge of $5.00.Equation:

Here we present the equation for determining the y.

y=1.75(x+5)

Therefore, the option c is correct.

learn more about the equation here: https://brainly.com/question/10821476

Last month, Mr. Douglas sold 36 of his books. This month, however, he only sold 8 books. What was the percent change in book sales from last month to this month?

A decrease of 77.77%
An increase of 3.5%
A decrease of 3.5%
An increase of 77.77%

Answers

Answer:

A decrease of 3.5%

Step-by-step explanation:

since 36-8 is 28, it went down a bit so it would be 3.5%

Answer:  A decrease of 77.77%. So the first option.

Find the product of the mixed numbers.


2
2
3
× 1
1
2
=

What statements are correct? Check all that apply.
Write the mixed numbers as improper fractions.
Multiply the numerators to get 24.
Multiply the denominators to get 6.
Write the improper fraction as a mixed number.
The product is 4.
The product is 2 and two-fifths.

Answers

Answer:

That statements that are correct are

1. Write the mixed numbers as improper fractions

2. Multiply the numerators to get 24

3. Multiply the denominators to 6

5. The product is 4

Step-by-step explanation:

2 [tex]\frac{2}{3}[/tex] × 1 [tex]\frac{1}{2}[/tex] = [tex]\frac{8}{3}[/tex] × [tex]\frac{3}{2}[/tex] = [tex]\frac{24}{6}[/tex] = 4

Hi hope this helps ;)  

1. Write the mixed numbers as improper fractions

2. Multiply the numerators to get 24

3. Multiply the denominators to 6

4. Write the improper fraction as a mixed number.

5. The product is 4

What is 5×6×7/19×5.898 = ?
100 Points Exclusive !!!

Answers

Answer:

65.188421

Step-by-step explanation:

hope i helped<3Have a nice day and remember to drink water!

Answer:

65.1884210526

Step-by-step explanation:

((5 * 6 * 7) /19) * 5.89800 = 65.1884210526

have a great day!

4. Wilfredo buys 2/5 pound of mixed nuts for $2.50. at this rate how many pounds of mixed nuts can he buy for $10

Answers

Answer: Wilfredo can buy 1 3/5 pounds of Mixed Nuts for $10

Step-by-step explanation:

2/5*4=8/5

$2.5*4=$10

8/5=1 3/5 pounds for $10

Sorry you have the answer so I’m gonna steal points sorryyyy

PLEASE HELP IF YOU NEED ME TO TELL YOU THE INFO FOR A.) I WILL
b) During the shot put event, Alayna throws the ball 32.45 feet while her teammates
throw 28.34 feet, 26.59 feet, and 33.11 feet. Use an estimation strategy to determine about how many total feet were thrown by the team. Describe the estimation strategy you used to solve the problem. (2 points)

Answers

28.34 can be estimated to the nearest number, which is 28. 26.59 can be estimated to the nearest number, which is 27. 33.11 can be estimated to the nearest number, which is 33. 28+27+33=88
It is 88 I checked the other girls answer and they are right :)

I will give brainliest if you get it right and 1st please answer this question?!!

Answers

Answer: The first step is to subtract 6.1 on both sides.

The second step is to divide 1.4 on each side.

The answer is  6.5

Step-by-step explanation:

There are many properties of exponents. These properties are used to make problems with exponents simpler.

Choose one of the properties and explain why it is true. Then write a numerical expression and use the property you chose to simplify the expression.

Answers

Answer:

The product rule of exponents

Step-by-step explanation:

An expression is 6xa^3 x 3xa^4

This can be hard to answer but there are three rule. 1st you keep the base which is a. 2nd is add the exponents which are 4 and 3. 3rd is multiply the coefficient which is 6 and 3. and this answer would be 18xa^7.

Plz help me for points

Answers

I can't see number 4.

Hope this is good enough for you.

Pls mark me brainliest

A copy machine can print 480 copies every 4 minutes. For each question, explain your reasoning.
– PART A: How many copies can it print in 10 minutes?
– PART B: A teacher printed 720 copies. How long did it take to print?

Answers

800 because 8 mins = 480 times 2 = 560, 2 mins = 480/2 = 240, 10 mins = 560 + 240 = 800

Answer:

Part A =1200 copies

Part B = 6 hours

Step-by-step explanation:

Part A is 480 divided by 4 = 120 and then 120 times 10 = 1200

Part B is 720 divided by 120 = 6

hope this helps

Please help! (I'll give brainliest if it's right!)

Answers

Answer:

1. Just plot the points (the first number is x, the second is y)

2. Q3

3. Q1: (5,3) Q2: (-3,5) Q3: (-4,-2) Q4: (1,-4)

What is the Fitness gram PACER test :)
(Can we get a PE subject?)

Answers

Answer:

The fitness gram pacer test is where u have to run from one point to another at a certian pace and the pace gets faster as you keep doing it.

Step-by-step explanation:

(brainliest???)

Answer: a meme

jk heres the real answer

the fitness gram pacer test is a multistage aerobic capacity test that progressively gets more difficult as it continues. The test is used to measure a students aerobic capacity as part of the fitness gram assessment. Students run back and forth as many times as they can, each lap signaled by a beep sound.

Think about how you can use absolute value notation to express the distance between two points on a coordinate graph. For each pair of points below, find the distance between the given points and express your work using absolute value symbols.

(4, 9) and ( –5, 9)

Answers

Ans: 9 points

Step-by-step explanation:

You cried the nines out since they are the same number in each coordinate. You are left with the expression |4| + |-5| witch is equal to 4 + 5. The answer would be 9 and the expression is |4| + |-5|


Hope that helps :)

The table below shows field goal statistics for three different kickers. Order the kickers by their field goal success rate from least to greatest. I have added a picture of the graph.

Answers

Answer:

Kicker C, kicker B, and then kicker A

Step-by-step explanation:

Just divide the field goals made by field goals attempted to get the success rate. A = 12 / 14 = 0.857      B = 15 / 18 = 0.83      C = 19 / 24 = 0.79

0.79 < 0.83 < 0.857

I agree with the other person

please help me, i'm no good at probability.

Answers

the answer is D I toke the test and got it correct
Answer is D. hope this helps

Chris paddles 5 miles down a stream in 3 hours. How far will she have paddled in 9 hours at this rate?

Answers

Answer: 15 miles

Step-by-step explanation: 5 miles / 3 hours = 1.6

1.6 x 9 = 15

15 Miles, you multiply 5 x 3 = 15!

What should the following equation be multiplied by in order to eliminate the fractions?
x/2+x/3=25/3
a.5
b. 25
c. 6

Answers

C. 6
Step-by-step explanation:
try multiplying everything by one of the numbers
(x/2)6 + (x/3)6 = (25/3)6
6x/2+ 6x/3 = 150/3
3x +2x = 50
The correct answer should be C! I’m not 100% sure though.

Ruth decides to use the method of proportions and similar triangles to find the height of a tree. She measures the length of the tree's shadow and finds it is 12 feet long. Then she holds a 12-inch ruler perpendicular to the ground and finds that it casts a 6-inch shadow. How tall is the tree? a. 2 ft c. 24 ft b. 6 ft d. 144 ft

Answers

Answer:

c. 24 ft

Step-by-step explanation:

if the 12 inch ruler casts a 6 inch shadow (shadow has half size) then a tree with 12 feet long shadow will have a height of 24 feet

Please help with algebra!!! ill give brainliest
linear equations with one variable (show work)
9 equations

Answers

Answer:

answer is attached in the image below

17. -6b + 20 = -16
-6b+20-20= -16-20
-6b = -36
b = 6
18. -4m + 2 = 14
-4m + 2 -2 = 14 - 2
-4m = 12
m=-3
19. -9c-4=-4
-9c-4+4=-4+4
-9c=0
c=0

20. 2y- (-10) = 18
2y+10=18
2y+10-10=18-10
2y=8
y=4

21. 1/2g+2=6
0.5g+2=6
0.5g+2-2=6-2
0.5g=4
g = 8

22. 3r-25=5
3r-25+25=5+25
3r = 30
r =10

23. 2/3s-(-4)=8
2/3s+4=8
2/3s+4-4=8-4
2/3s=4
s=6

24. 4/5a+(-5)=0
4/5a-5=0
4/5a-5+5=0+5
4/5a = 5
a= 25/4 aka 6.25

25. -2/7w -6 = -4
-2w/7=2
(-7/2)(-2a/7)=(7/2)•2
a=-7

Karen bought 3.35 pounds of chicken and 2.7 pounds of turkey to make sandwiches. How many pounds of meat did she buy?

Answers

Answer:

6.05 pounds of meat

Step-by-step explanation:

3.35 lbs. + 2.7 lbs. = 6.05 lbs.

Karen bought a total of 6.05 pounds of chicken.

6.05 pounds of meat!

Lucy is shopping for her younger brother's birthday party. All ten of their family members will be at the party.

She finds a package of five noise-makers for $1.50. At this rate, how many packages will she need to buy so that each person has one noise maker?

A.4 packages
B.12 packages
C.6 packages
D.3 packages
E.2 packages

Answers

Answer:

2

Step-by-step explanation:

one package has 5 and 5+5 =10 the amount of people at her brothers party so if one package has 5 and it takes two 5s to get to 10 then it is two

hopefully this helps :)

2 packages because there is 10 family members and each package brings 5 so if it brings 5 then 2 packages would be 10. there are 10 family members so each family member will have a noise maker

Which pair shows equivalent expressions? PLEASE HELP AND DON"T DO FAKE THINGS AND MAKE THEM UP!!!!
2x+10=2(x-5)
-2(x+5)=2x-10)
-2x-10=-2(x+5)
-2(x-5)=-2x-10

Answers

Answer:

The answer would be D I believe.

Step-by-step explanation:

The -2's and the x = 2 so they should be equivalent. But I dont know :/

Answer:

The answer would be C

Step-by-step explanation:

C is the only one that have the same numbers on both sides.

A would be 2x+10=2x-10

B would be -2x-10=2x-10

C would be -2x-10=-2x-10

D would be -2x+10=2x-10

Please help i will give brainliest...
I need in form of y=mx+b Thank you!

Answers

Answer:

y = -2x + 3

Step-by-step explanation:

Let equation of the line be y = mx + b

Since the line is perpendicular to y = 1/2x - 10,

product of the gradient of both lines = -1

therefore,

1/2 x m = -1

m = -2

since it passes through (4, -5),

sub (4, -5):

-5 = -2(4) + b

b = 3

therefore, equation of the line is y = -2x + 3

Other Questions
I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal? I do not breathe, but I run and jump. I do not eat, but I swim and stretch. I do not drink, but I sleep and stand. I do not think, but I grow and play. I do not see, but you see me every day. What am I? Both pieces of writing attacked the practices of the Catholic Church. Yet one led to a complete break, while the other did not. What in Luthers words seems uncompromising, and what in Erasmus words leaves more room for reform? What is the main function of the small intestine?(use terms : villi, surface area,blood capillaries,why must large molecules be broken down, high concentration and low concentration.) can anyone just explain how to do a distant rate time problems because I'm confused about them -4/9 divided by 2/3 what would the answer be? (First to answer gets brainiest)What three languages did theRosetta Stone, discovered in AncientEgypt, contain?A. Arabic, Baltic, and EnglishB. hieroglyphic, English and SomaliC. hieroglyphic, demotic and EnglishD. hieroglyphic, demotic and Greek What enrionmental factor can people with pku control to prevent building up extra phenylalanine in thier brains "God lends a helping hand to the man who tries hard". Justify the quote with reference to the lesson Weathering the storm in ersama Read and choose the correct option to complete the sentence.Antes de viajar el viernes, voy a ________ la ropa en la maleta. (1 point) aempacar bhacer cplanificar dpoder Pls help me8th grade English Can Anybody Help With Geometry Work?