Select the correct answer. convection is a mode of heat transfer for which types of objects?
a. solids and liquids
b. gases and solids
c. gases only
d. liquids and gases e. liquids only

Answers

Answer 1

a). Convection is a mode or process of heat transfer for solids and liquids.

Convection is a process of heat transfer that occurs through the movement of fluids. It is the main mode of heat transfer in liquids and gases and is commonly used to transfer heat between two solid objects.

During convection, heat is transferred by the movement of particles or molecules in the fluid. The heat is transferred by the interaction of the particles or molecules with each other and the objects they come into contact with.

The particles or molecules that are hotter will transfer energy to the particles or molecules that are cooler. This causes the cooler particles or molecules to become hotter, resulting in heat transfer from one object to the other.

For more questions like Convection click the link below:

https://brainly.com/question/29645809

#SPJ4


Related Questions

 (Question) How many atoms are in 3 grams of Cu?
(20 points)

Answers

3 grams of Cu = 6.022 x 10^23 atoms of copper.

Answer:

2.84 × 10^22 atoms

Explanation:

To calculate the number of atoms in 3 grams of Cu, we can use avogadro's constant where:

[tex]1 \: mole = 6.02 \times 10 {}^{23} \: atoms[/tex]

Firstly, we have to calculate the number of moles in 3 grams of Cu. The formula to calculate moles is:

[tex]moles = \frac{mass}{molar \: mass} [/tex]

the mass = 3g and the molar mass = 63.55 (this value can be found in the periodic table)

Substitute the values in formula:

[tex]moles = \frac{3}{63.55} [/tex]

[tex]moles = 0.0472[/tex]

Now use the number of moles to convert to atoms using avogadro's number, where x is the unknown number of atoms we want to find:

[tex]1 \: mole : 6.02 \times 10 {}^{23} \: atoms[/tex]

[tex]0.0472 \: moles : x \: atoms[/tex]

Cross multiply and equate to solve for x:

[tex]1 \times x = 6.02 \times 10 {}^{23} \times 0.0472[/tex]

[tex]x = 6.02 \times 10 {}^{23} \times 0.0472[/tex]

[tex]x = 2.84 \times 10 {}^{22} \: rounded \: to \: 3sf[/tex]

Hence, there are 2.84 × 10^22 atoms in 3 grams of Cu

Which of thee would NOT
be conidered a biome?
A. A region that ha everal grouping of
the ame plant communitie. B. A region that ha everal grouping
of the ame animal communitie. C. A mall habitat that contain it own
ecoytem (uch a a tree tump). D. A large area of the Earth that ha a
imilar climate

Answers

A large area of the Earth that has a similar climate is not considered a biome.

Hence, option D is correct.

Scientists can identify a biome by defining the range of temperatures, the kind of soil, the amount of light, and the amount of water that are distinctive to that location. These factors create niches for particular species.A biome is a community made up of all the habitats in a given region and climate, whereas a habitat is the place where a group of one type of organism (a population) resides. Different creatures live in many types of biomes.

Scientists disagree on the exact number of biomes that exist on earth, therefore we will focus on the six most significant ones: freshwater, marine, desert, forest, grassland, and tundra.

To know more about biome here

https://brainly.com/question/1930321

#SPJ4

What is a proposed explanation for an observation? A. experiemnt B. hypothesis C. theory D. scientific law

Answers

A proposed explanation for an observation is theory. Option C is the correct answer.

What is a theory?

This refers to a carefully articulated explanation for observations of the natural world that have been arranged using the scientific method, gathering many facts and hypotheses.

A proposed explanation for an observation is a statement or theory that attempts to explain or account for an observation. It is a possible explanation for a phenomenon and is often based on available evidence, research, and data. It may be tested and refined through further observation and experimentation to determine its accuracy and validity.

Learn more about theory on

https://brainly.com/question/29457011

#SPJ1

The rate law for the reaction2NOBr

Answers

The rate constant of the reaction is 0.56 M⁻¹s⁻¹. The time required to change the concentration of the reactant from 0.900 to 0.100 M is 15.87s.

What is the half-life period of a reaction?

The half-life of a reaction can be defined as the time needed for a reactant to reach one-half of its initial concentration. For a 1st-order reaction, the half-life is independent of concentration and constant with time.

The half-life period of the second-order reaction can be written as:

[tex]\displaystyle t_{1/2} =\frac{1}{k[A]_o}[/tex]

Given the half-life of the reaction = 2.00 s

The initial concentration of [NOBr]₀ = 0.900 M

The rate constant of the reaction, k = 1/2 ×0.900 = 0.56 M⁻¹s⁻¹

The time required to change concentration from 0.900 to 0.100 M is:

[tex]\displaystyle kt =\frac{1}{[A]} -\frac{1}{[A]_o}[/tex]

0.56 ×t = 1/0.1 -1/0.9

t = 15.87 s

Learn more about half-life period, here:

https://brainly.com/question/1851154

#SPJ1

For each of the following chemical equations, write all possible mole ratios. a. 2HgO(s) → 2Hg(l ) + O2(g) b. 4NH3(g) + 6NO(g) → 5N2(g) + 6H2O(l ) c. 2Al(s) + 3H2SO4(aq) → Al2(SO4)3(aq) + 3H2(g)

What is c. 2Al(s) + 3H2SO4(aq) → Al2(SO4)3(aq) + 3H2(g)

Answers

a) The mole ratio is 2/1

b) The mole ratio is 4/6

c) The mole ratio is 2/3

What is the mole ratio?

We have to note that the mole ratio is the ratio of the stoichiometric coefficient that we have between two reactants that can be found in an equation. In the case of the reaction equations that we have, we must look closely at each equation.

As we can see, each of the reaction equations is balanced and we can now be able to obtain the mole ratio of each of the reaction as shown in the answer above.

Learn more about mole ratio:https://brainly.com/question/15288923

#SPJ1

the efficiency of the turbines and generators is 80%

calculate the useful output energy transfer from the hydroelectric power station in 1 minute

use your answer to part (b)

Answers

What was your answer to part (b)?

Which of the following can result in deviations from Beer\'s law when the path length is constant? Solute concentrations less than 0.01 M Stray light reaching the detector The absorbing species undergoes dissociation or association The sample is homogeneous The use of polychromatic radiation

Answers

The option that can lead to deviations from Beer's law at constant path length is option A.

Using monochromatic radiation All radiation that was not absorbed by his sample when stray light reaches the detector is transmitted to the detector.

All of the above factors can lead to deviations from Beer's Law if the path length is constant. Optical pathlength refers to the distance that light travels through a sample and is usually kept constant in spectrophotometric experiments in order to accurately measure the sample's absorbance.

Therefore, unless monochromatic radiation is used, the absorbance of the sample may not accurately reflect the concentration of the solute, as different wavelengths of light may be absorbed differently.

For more information on Beer's Law kindly visit to

https://brainly.com/question/18591932

#SPJ4

How can light help us understand atoms?

Answers

Answer: We can calculate the energy levels of an atom

Explanation:

Spectral lines tell us how many different energy levels an atom has, and how far apart those energy levels are spaced.This is possible because spectral lines are the result of an excess (emission lines) or deficiency (absorption lines) of observed photons emitted from certain types of matter. The lines are caused by electrons moving between energy levels within individual atoms. Since each element emits it's own unique spectrum, this means that different types of atoms must have a distinct number of electrons in very particular energy levels.

How many mol ratios can be obtained from the following chemical equation? Na2s + cd(No3)2 ———-> 2 NaNo3 +cds

Answers

12mol ratios can be obtained .



In chemistry, what is the net ionic equation?

The net ionic equation is a chemical equation that only depicts the elements, compounds, and ions that are directly involved in the chemical process.
As previously stated, we employ net ionic equations to highlight the molecules that change throughout the reaction. It makes it simple to identify the active molecules in a reaction since they are the only ones in the equation.

Fill in the blanks with the balanced molecular equation.
For each substance, write the state (s, l, g, aq).
Break down strong electrolytes into ions (the complete ionic equation).
Remove the spectator ions from both sides of the full ionic equation.



To learn more about mol ratios  to refer:
https://brainly.com/question/29478671
#SPJ1

How many planes of cleavage does this mineral have? Choose one: A. 0 B. 2 at 90° intersections C. 3 not at 90° intersections D. 1

Answers

The planes of cleavage that the mineral have is 1 as the mineral name is Muscovite mica.

The crystal lattice structure of a mineral affects its propensity to split or break along flat planar faces, or cleavage. These 2D surfaces, also known as cleavage planes, are produced by the alignment of atoms in the crystal structure or lattice through relatively weak connections.

The mineral depicted in the image is called "Muscovite mica," and it has layers that seem like flat sheets. Muscovite mica is far more likely to break along the layers because it only has weakly bonded potassium ions. There is just one ideal cleavage plane as a result. This cleavage is evident in the capacity to peel mica sheets.

Learn more about cleavage

brainly.com/question/10924382

#SPJ4

what is the total random kinetic energy of all the molecules in one mole of hydrogen at a temperature of 300k

Answers

The total random kinetic energy of all the molecules in one mole of hydrogen at a temperature of 300k is 3741.3 J.

Given temperature (T) = 300K

The number of moles of hydrogen given are (n) = 1

Molecular weight of hydrogen (M) = 1g

Let the kinetic energy = KE

We know that Kinetic Energy (KE) = 1.5nRT where R = Rydbergs constant

So, KE (total) = 1.5nRT,

the total random kinetic energy is KE = (1.5) x (1) x (8.314) x (300) = 3741.3J/mol

The energy of motion is known as kinetic energy, and it can be observed in the motion of objects or subatomic particles. Examples of kinetic energy in action include a person walking, a baseball soaring through the air, a piece of food falling from a table, and a charged particle in an electric field.

To learn more about hydrogen click here https://brainly.com/question/11837837

#SPJ4

Is it true that only 2 ATP are formed during anaerobic respiration?

Answers

Pyruvate is converted to lactate in anaerobic conditions by anaerobic glycolysis. During anaerobic respiration, two ATP molecules are produced.

What is the primary step in glycolysis?

The method by which glucose is metabolized to produce energy is known as glycolysis. It generates water, ATP, NADH, and two pyruvate molecules. It doesn't need oxygen to happen because it happens in a cell's cytoplasm. Both in aerobic and anaerobic organisms, it happens.

How is glycolysis referred to?

Gustav Embden, Otto Meyerhof, & Jakub Karol Parnas identified the Embden-Meyerhof-Parnas (EMP) pathway, which is the most typical kind of glycolysis. The Entner-Doudoroff pathway and several heterofermentative & homofermentative pathways are examples of additional pathways that are included in the term "glycolysis."

To know more about glycolysis visit:

https://brainly.com/question/14076989

#SPJ4

In anaerobic circumstances, anaerobic glycolysis converts pyruvate to lactate. Two ATP molecules are created during anaerobic respiration.

What is the first stage of glycolysis?

The process of converting glucose into energy is known as glycolysis. Water, ATP, NADH, and two pyruvate molecules are produced. It does not require oxygen to occur since it occurs in the cytoplasm of a cell. It occurs in both aerobic and anaerobic species.

How is glycolysis defined?

The Embden-Meyerhof-Parnas (EMP) route, which is the most common kind of glycolysis, was discovered by Gustav Embden, Otto Meyerhof, and Jakub Karol Parnas. Additional processes included in the word "glycolysis" include the Entner-Doudoroff pathway and numerous heterofermentative and homofermentative pathways.

Here,

Anaerobic glycolysis converts pyruvate to lactate under anaerobic conditions. During anaerobic respiration, two ATP molecules are produced.

To learn more about glycolysis, go to:

brainly.com/question/14076989

#SPJ4

Spreadsheets are super helpful in helping you stay organized when calculating recipe costs because they have different rows and columns to track all your _____ individually and what they cost.

Question 1 options:

ideas


customers


ingredients


reviews

Question 2 (1 point)
Ryan is a baker who likely does what to his ingredients rather measuring them out with cups?

Question 2 options:

splitting up


sharing


weighing out


cultivating

Question 3 (1 point)
What company has a trade secret that claims to use "eleven herbs and spices," supposedly scribbled on a piece of yellow notepaper inside an iron safe in Louisville, Kentucky, and as the story goes, the safe is actually a vault surrounded by cameras, motion-detectors, and even guards!

Question 3 options:

Chik-Fil-A


Coca Cola


McDonald's


Kentucky Fried Chicken

Question 4 (1 point)
What kind of measuring device comes in sets, with each part of the set holding a pre-determined volume and increasing in size from ¼ to 1?

Question 4 options:

strain measuring spoons


conversion measuring spoons


tare measuring cups


standard measuring cups

Question 5 (1 point)
What kind of cups for measuring are sometimes made from glass or something transparent so the markings on the side with different measurements are visible?

Question 5 options:

graduated measuring cups


standard measuring cups


tare measuring cups


Maillard measuring cups

Question 6 (1 point)
Schools, hospitals, prisons, universities, summer camps, and government buildings are just a few examples of the types of institutions and commercial kitchens that depend on what kind of recipes on a daily basis?

Question 6 options:

trade secret recipes


small volume recipes


improvised recipes


standardized recipes

Question 7 (1 point)
As a big-time chef, your job entails nothing more than simply putting out spectacular food.

Question 7 options:

True


False

Question 8 (1 point)
Rice never loses its food value, regardless of how many times its rinsed.

Question 8 options:

True


False

Question 9 (1 point)
When a food cost analysis is properly done, it can serve as a tool to monitor your overall expenses so you can make a profit and stay within the confines of your budget.

Question 9 options:

True


False

Question 10 (1 point)
When looking for consistency and reliability, in cooking and other endeavors, it's far better to rely on what rather than guesswork?

Question 10 options:

intuition


hypotheses


numbers


estimates

Question 11 (1 point)
Most failing restaurants find themselves in trouble because they do not understand the what that is associated with what they are doing?

Question 11 options:

cost


time


resilience


integrity

Question 12 (1 point)
When adhering to the ABCs of eating when planning out your diet, ensuring that you are not too heavy on fat, salt, or sugar means that you are using what?

Question 12 options:

adequacy


moderation


variety


balance

Question 13 (1 point)
Inventory control provides predictable information on the quantity of ingredients needed for each _____ cycle.

Question 13 options:

revenue


standardized


nutrient


production

Question 14 (1 point)
As delightful as it is to design a delicious, exciting, and colorful menu, it is equally as important to see the hidden costs and risk behind every decision.

Question 14 options:

True


False

Question 15 (1 point)
What happens to ingredients through the process of trimming, cleaning, and cooking?

Question 15 options:

They shrink.


They grow.


They disintegrate.


They multiply.

Answers

Answer:

A-Ideas

Explanation:

How does a meter stick measure reaction time?

Answers

We can use the distance when the meter stick fell before you caught it to figure out your reaction time.  

Meterstick is either a straightedge or foldable ruler which is used to measure a  length, and is especially common in the construction industry. They are often made up of wood or plastic, and often have metal or plastic joints so that they can be folded together. Metersticks are usually divided with lines for each millimeter (1000 per meter) and numerical markings as per centimeter (100 per meter), with the numbers or either in centi- or millimeter.

Formula is the basis: d = 1/2 gt2. In this formula, “d” is equals to the distance the object fell, “g” equals to gravitational acceleration (9.8 m/s2), and “t” is the time the object was falling.

To know more about meterstick here

https://brainly.com/question/29690562

#SPJ4

when a set amount of marble chips (caco3) is added to a small amount of dilute hydrochloric acid, a reaction occurs. what should be done to decrease the rate of reaction the next time the experiment is performed

Answers

A tiny amount of weak hydrochloric acid is mixed with a quantity of marble chips (CaCO3), to decrease the rate of reaction we do decreasing the surface area of the marble chips, decreasing conc. HCL and many more.

Several ways are:-

1. Decreasing the surface area of the marble chips: By breaking the marble chips into smaller pieces, the surface area that is available for the acid to react with is reduced, slowing down the reaction.

2. Decreasing the concentration of the hydrochloric acid: By using a less concentrated solution of hydrochloric acid, the number of acid molecules available to react with the marble chips is reduced, slowing down the reaction.

3. Increasing the temperature: By performing the reaction at a lower temperature, the kinetic energy of the acid and marble chip molecules is reduced, slowing down the rate of collision between them, which slows down the reaction.

4. Using a catalyst: Addition of a catalyst to the reaction can change the reaction mechanism and decrease the activation energy needed for the reaction to occur, thus slowing down the reaction.

5. Using an inhibitor: An inhibitor is a substance that slows down the reaction by binding to the enzyme or catalytic site and preventing the substrate from binding.

It's important to note that these methods may also affect the overall yield of the reaction, so it's essential to use the appropriate method(s) for the specific experiment and goals.

To know more about hydrochloric acid please refer: https://brainly.com/question/14006357

#SPJ4

Question 4

3 pts

Which if the following elements will not reach an octet when in a bond?

Calcium

O Lithium

Magnesium

O Carbon

Ouestion 5

Answers

Lithium has a valence of 1, so it will not usually reach an octet in a bond. It tends to form ionic bonds, in which there is only one electron transfer, rather than two or more which would be required to reach an octet.

What is Lithium?

Lithium is a soft, silver-white metal that is the lightest of all alkali metals. It is a key component in many batteries, and is also used in a variety of other applications. It has a low reactivity, and is relatively stable when exposed to air and water. In its elemental form, Lithium is a highly flammable, corrosive metal that is rarely found in its pure form in nature. It can be found in minerals such as lepidolite and spodumene, and is commonly mined from salt flats and brine pools.

To learn more about Lithium
https://brainly.com/question/15178590
#SPJ4

What happens to molecules when they move faster?

Answers

When molecules move faster, they increase their kinetic energy.

What is Kinetic energy?

Kinetic energy is essentially the energy of motion. It is the type of energy that an object possesses as a result of its motion. It is commonly defined as the work required to accelerate a given mass body from rest to its stated velocity. Kinetic energy is directly related to the object's mass and the square of its velocity.

This increase in kinetic energy causes the molecules to vibrate more rapidly, resulting in an increase in temperature. As molecules move faster, they also collide with each other more frequently, leading to more chemical reactions.

To know more about kinetic energy,

https://brainly.com/question/8101588

#SPJ4

Entropy and the inefficiency of energy transfer are part of __________________. the first law of thermodynamics the second law of thermodynamics the third law of thermodynamics system resiliency feedback systems

Answers

Entropy and the inefficiency of energy transfer are part of the Second Law of Thermodynamics.

The first law of thermodynamics states that neither creation nor destruction of energy is possible. The universe becomes more entropic when a spontaneous process occurs, according to the second law of thermodynamics. Thermodynamics' third law: The entropy of a perfect crystal is 0 at absolute zero Kelvin. The overall entropy of a system may only ever increase or stay constant during spontaneous processes, according to the second law of thermodynamics. If the physical process is irreversible, the overall entropy of the system and its surroundings must increase. For a process to be irreversible, the final entropy needs to be higher than the starting entropy: Sf > Si (irreversible process). The overall entropy of a system and its surroundings can remain constant when a system is in thermodynamic equilibrium or undergoing a reversible process. The second law is sometimes known as the Law of Increased Entropy.

To learn more about entropy click here https://brainly.com/question/24278877

#SPJ4

Indicate whether each of the following molecules is capable of geometrical (cis-trans) isomerism. Check all that apply. O 1,3-dichloro-2-butene O 1,4-dichlorobenzene O 1,1-dichloro-1-butene O 4,5-dimethyl-2-pentyne

Answers

1,3-dichloro-2-butene and 1,1-dichloro-1-butene.Geometrical isomerism, also known as cis-trans isomerism, occurs when a molecule has two or more  structural isomers that differ in the spatial arrangement of the atoms.

Cis-trans isomerism is only possible when the molecule has at least one carbon-carbon double bond. In this type of isomerism, the two isomers differ in the orientation of the substituent groups around the double bond.  1,3-dichloro-2-butene and 1,1-dichloro-1-butene both contain a carbon-carbon double bond and are therefore capable of geometrical isomerism. 1,4-dichlorobenzene does not contain a carbon-carbon double bond and therefore is not capable of geometrical isomerism. 4,5-dimethyl-2-pentyne also does not contain a carbon-carbon double bond and is therefore not capable of geometrical isomerism.

learn more about isomerism here

https://brainly.com/question/14015257

#SPJ4

what is the mole fraction of ethanol c2h5oh in an aqueous solution in which the ethanol concentration is 4.6 molal

Answers

The mole fraction of ethanol, C2H5OH is 0.076 that can be calculated by using the density of water.

The mole fraction of any solution is described because the ratio of the quantity of moles of that is present withinside the technique to the entire quantity of moles of all of the additives of the solution. Molarity on the other hand is the ratio of moles to the volume.

Molecular mass of ethanol = 46g

The molarity of the solution is 4.6 molal=4 moles in 1L solution

Molecular mass of water =18g

Density of water = 1kg/m3 = 1000g/L

So, mass of water in 1 l solution = 1000g

So moles = 1000/18 = 55.55 moles

Thus, mole fraction of ethanol= 4.6/(4.6+55.6) =0.076

To learn more about mole fraction check the link below:

https://brainly.com/question/1601411

#SPJ4

What is the cause of periodic repetition of properties of elements?

Answers

The periodic repetition of properties of elements is due to the regular arrangement of electrons in the atoms of those elements. This regular arrangement is known as the "periodic table" of elements. This is due to the behavior of electrons in atoms and the increasing number of valence electrons as atomic number increases, resulting in a regular pattern of electron configurations and properties.

Elements are arranged in the periodic table according to increasing atomic number. Elements in the same vertical row (group) have similar chemical and physical properties, and elements in the same horizontal row (period) have similar electronic configurations of their atoms.

The reason for this repeating periodic property is the behavior of the electrons in the atoms. As the atomic number increases, the number of protons in the nucleus increases, and the number of electrons in the atom increases. These electrons occupy different energy levels or shells around the atomic nucleus. The outermost shell electrons, the so-called valence electrons, are responsible for the chemical behavior of atoms and participate in chemical bonds. As the atomic number increases, the number of valence electrons in the atom increases. This results in a regular pattern of electron configurations and thus a regular pattern of properties.

Learn more about periodic repetition here:https://brainly.com/question/1917984

#SPJ4

A chemist is studying the composition of a sample of ocean water. He gently heats the sample to evaporate the water, leaving him with the solid substances that had been dissolved in the sample. Next, he performs a series of procedures to separate the solid substances from each other. Finally, he measures how much of each solid he has obtained. What substance would he probably have the most of

Answers

The substance that he will have the most will be sodium chloride.

More than 70% of the surface of the Earth is covered by seawater, the liquid that makes up the oceans and seas. 96.5 percent of seawater is made up of pure water, 2.5 percent salt, and minor amounts of dissolved inorganic and organic compounds, particles, and a few atmospheric gases.

When a chemist analyzes the composition of a sample and heats it to cause the water to evaporate, he is left with the solid substances that had been dissolved in the sample. Sodium chloride is the most significant salt that is created by ocean water. He next goes through a series of steps to separate the solid materials from one another. The highest substance found in ocean water, according to his measurements, is salt, specifically sodium chloride.

Learn more about sodium chloride

brainly.com/question/9811771

#SPJ4

An oxygen-binding protein was purified from a mollusk. It was found to exhibit fluorescence, which means that it has amino acid residues that absorb light of one wavelength and then emit light of a longer wavelength. Generally, the more exposed these residues are to solvent, the greater their fluorescence intensity. When placed in a deoxygenated buffer solution, the protein's fluorescence was measured and assigned a value of 1.0. Then the amount of protein fluorescence was measured under various other conditions and expressed relative to the initial measurement. The results are summarized in the table. Which conclusion is supported by these results

Answers

The conclusion is supported by these results is binding of oxygen to the protein changes the protein's tertiary structure to a conformation that resists the effects of urea.

Simple definition of fluorescence

Fluorescence is a property that some chemicals have that allows them to emit visible light after absorbing radiation that is typically invisible, like ultraviolet light.

Fluorescence is the name given to the process of electromagnetic radiation typically visible light emitting from a material as a result of atoms being excited. These excited atoms almost immediately (within 10⁻⁸ seconds) begin emitting again. In most cases, the initial excitation is brought on by the energy absorption of incident radiation or particles, like X-rays or electrons.

To know more about fluorescence visit:

https://brainly.com/question/24228588

#SPJ4

How many oxygen atoms are in 2.50 L of oxygen?

Answers

Answer:

There are 8.30x104-24 atoms of oxygen in 2.50 mol of oxygen gas. There are 7.53x10*23 atoms of oxygen in 2.50 mol of oxygen gas.

A 0.470-g chunk of sodium metal is cautiously dropped into a mixture of 50.0 g of water and 50.0 g of ice, both at 0°C. The reaction is given below.
2 Na(s) + 2 H2O(l) 2 NaOH(aq) + H2(g) ΔH = -368 kJ
Will all the ice melt? The enthalpy of fusion for ice is 6.02 kJ/mol.

What is the amount of heat released?
_____ kJ
What is the amount of heat required to melt 50.0 g of ice?
_____ kJ
Assuming the final mixture has a specific heat capacity of 4.18 J/g · °C, calculate the final temperature.
_____kJ

Answers

Ice will not melt as we need 16.72 KJ of heat but we have only 3.76 KJ

What is the enthalpy of fusion?

In thermodynamics, the enthalpy of fusion can be described as the change in its enthalpy resulting from giving energy, heat, to a specific amount to change its state from a solid to a liquid.

Given the reaction is  2 Na (s) + 2 H₂O(l) → 2 NaOH (aq) + H₂ (g)

Given the mass of sodium = 0.470 g

The moles of sodium = 0.470/23 = 0.020 mol

Given that two moles of sodium (Na) release heat = 368 KJ

Heat released by 0.020 mol of sodium (Na) = (368/2) × 0.020 = 3.76 KJ

Given the mass of ice = 50g

The number of moles = 50/18 = 2.78 mol

For melting, one mole of ice heat is required = 6.02 kJ/mol.

For 2.77 mol of ice = 6.02 × 2.78 = 16.72 KJ

But we have only 3.76 KJ of heat therefore, the ice will not melt.

Learn more about enthalpy of fusion, here:

https://brainly.com/question/20897184

#SPJ1

Gaseous ammonia chemically reacts with oxygen O2 gas to produce nitrogen monoxide gas and water vapor. Calculate the moles of water produced by the reaction of 0.90mol of ammonia. Be sure your answer has a unit symbol, if necessary, and round it to 2 significant digits.

Answers

1.08 moles of water () produced by the reaction of 0.90mol of oxygen.

Explanation:

Moles of oxygen given = 0.90 mole

Moles of water are to be calculated.

Step 1 : Write the chemical reaction and balance it.

5 mole of  reacts with 4 mole of  to give 4 moles of NO and 6 moles of .

Step 2 : Calculate moles of water () utilising  mole ratio.

The coefficient of  is 6 and coefficient of  is 5, So mole ratio of  to  is 6 : 5

Moles of  = 0.90 × 6 (moles of ) ÷ 5 (moles of )

Moles of  = 1.08 moles

1.08 moles of  is produced by the reaction of 0.90 mole oxygen ()

For more information on moles visit: https://brainly.com/question/26416088

#SPJ4

You have been given a transparent liquid that could be a solution or a colloid. What is the test you
can perform to confirm which type of mixture it is? What is the technical name for this test?

Answers

Answer: Filterability Test

Explanation: This involves filtering the liquid through a filter paper to see if the particles pass through or are retained on the paper. If the particles pass through, the liquid is likely a solution. If the particles are retained, the liquid is likely a colloid. The technical name for this test is the separation test.

Answer:

One way to determine whether a transparent liquid is a solution or a colloid is to use the Tyndall effect. The Tyndall effect, also known as the Tyndall scattering, is a phenomenon that occurs when a beam of light passes through a colloidal system (a mixture in which one substance is dispersed evenly throughout another). When this happens, the light is scattered by the particles in the colloidal mixture, causing the mixture to appear hazy or cloudy. In contrast, if the transparent liquid is a true solution (one in which the solute is completely dissolved in the solvent), the light will pass through it without being scattered, and the solution will appear clear.

To perform the Tyndall effect test, you would need a light source (such as a flashlight or a laser pointer) and a dark room or area. Place the transparent liquid in a clear container, and shine the light through it. If the light is scattered by the particles in the mixture, it will be visible as a bright beam or spot on the opposite side of the container. If the light passes through the mixture without being scattered, it will appear as a continuous, unbroken beam.

There are other tests that can be used to distinguish between solutions and colloids, such as the filterability test and the centrifugation test. However, the Tyndall effect test is one of the most straightforward and reliable methods for making this distinction.

Explanation:

After watching the 2nd video, select the correct results to fill in the chart below:

what am I doing wrong

Answers

KI - Ionic compound, KCl -Ionic compound,

C₆H₁₂O₆ - Covalent compound, C₆H₄Cl₂ - Covalent compound,  

KNO₃ - Ionic compound, C₆H₅COOH - Covalent compound

CH₃COOH - Covalent compound, Paraffin wax - Covalent compound

HCl - Covalent compound

What are ionic and covalent compounds?

Ionic compounds are formed from the interaction between cation ions and anions. A cation of an atom can be described as an electropositive ion and can donate valence electrons. Similarly, anions of an atom are electronegative ions and can accept electrons.

In an ionic compound, there is a complete transfer of electrons in the formation of an ionic bond, therefore, there exists an electrostatic force of attraction between the ions that forms a strong bond.

In a covalent compound, there is the mutual sharing of electrons in the covalent bonds. The shared electrons are hard to give away as nuclei of two atoms together share the electrons and create a bond stronger.

Learn more about the ionic and covalent compound, here:

brainly.com/question/12144907

#SPJ1

Given that 1 kWh = 3. 6 MJ and that 1 Btu = 1055 J, show that 1 kWh = 3412 Btu.

Answers

Given that 1 kWh = 3. 6 MJ and that 1 Btu = 1055 J, It is shown that 1 kWh = 3412 Btu.

1 kilowatt (kWh) = 3.6 mega Joules (MJ)

1 British thermal unit (Btu) = 1055 Joules (J)

As we know that:

1 MJ = 1000000 J

Since

1 kWh = 3.6 x 1000000 J

Calculate for 1 J

1 J = 1 ÷ 1055 Btu

1 kWh = 3.6 x 1000000 x (1 ÷ 1055) Btu

1 kWh  = 3412.32 Btu

So it is calculated that 1 kilowatt (kWh) is equal to 3412 British thermal units (Btu).

You can also learn about British thermal unit (Btu) from the following question:

https://brainly.com/question/19431525

#SPJ4

Explain what it means for materials to move down their concentration gradient and up their concentration gradient.

Answers

Moving down the concentration gradient means that materials move from an area of high concentration of the material to an area of low concentration of the material.

What is concentration?

In chemistry, concentration is the amount of a substance in a given space. Another way to describe concentration is the proportion of the solute to a solvent or entire solution. In general, mass/unit volume is used to express concentration. Instead of using volume, concentration can be stated as a mass per unit. Although concentration is typically used to describe chemical solutions, it may be computed for any mixture.

This can be seen in osmosis, where water moves from a higher concentration of solute to a lower concentration of solute.

To learn more about concentration

https://brainly.com/question/26255204

#SPJ4

Other Questions
Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10