Solve the system of equations:
{ x+y=6
y+3x=4
HURRY

Answers

Answer 1

Answer:

(-1,7)

Step-by-step explanation:

Equations:

x + y = 6

y + 3x = 4

Slope-Intercept Form:

y = -x + 6

y = -3x + 4

Graph:

Graph them yourself!

(On the graph they intersect at -1,7)


Related Questions

Is that the answer please help no links no links please help

Answers

Answer:

360

Step-by-step explanation:

V= L•W•H/3

10×12×9÷3

What is the slope of the line?

Answers

The slope of the line is 7/4

Answer:

-7/4

Step-by-step explanation:

Hi,

To find the slope of the line, get two points, and divide the change in y over the change in x. So, let's find two points.

(1,-3) and (-3,4)

Change in y: 4 - (-3) = 7 (Remember when you subtract a negative, you add)

Change in x: -3 - 1 = -4

7/-4 = -7/4

-7/4 is your slope.

I hope this helps :)

How to show full work on this one topic is angles formed by 2 chords and secants

Answers

Answer:

m<STR=149 degree

Step-by-step explanation:

To find m<STR

m PQ=186 degree

mSR=112 degree

m<STR=1/2(m PQ+MSR)

m<STR=1/2(186 +112)

⇒1/2(298)

answer⇒149

hope it helps...

The maximum speed that a sailboat can reach depends on the size of the boat. The graph below shows the maximum speed, v, that a sailboat can reach as a function of its length, l.
Complete the following sentences based on the graph of the function.

1. The longer the sailboat is, the [FASTER/SLOWER] it can go.
2. For a boat to reach the speed of 101010 kilometers per hour, it needs to be at least __ feet long.
3. The maximum speed that an 888-foot boat can reach is __ kilometers per hour.
4. A 16-foot sailboat at top speed is [1.5 times/2 times/2.5 times/3 times/3.5 times] as fast as a 4-foot sailboat at top speed.

Answers

Answer:

Review the graph to get answers:

1. The longer the sailboat is, the FASTER it can go. As it is a increasing function.

2. For a boat to reach the speed of 10 kilometers per hour, it needs to be at least 16 feet long.

3. The maximum speed that an 8-foot boat can reach is 7.1 kilometers per hour.

4. Top speed of a 16-foot boat is 10 kilometers per hour and of a 4-foot boat is 5 kilometers per hour.

The ratio is:

10/5 = 2 times

A 16-foot sailboat at top speed is 2 times as fast as a 4-foot sailboat at top speed.

i’m so confused now helpppppppppp!!!!

Answers

An exterior angle is equal to the sum of the two opposite interior angles.

X = 125 + 30

X = 155

Answer:

26 put me brinliest pleae!!

Step-by-step explanation:

NO LINKS.
12 ÷ x = 36
Find x.

Answers

Answer:

x=1/3 or 0.3

Step-by-step explanation:

Multiply to remove the fraction, then set equal to  0  and solve.

Answer:

Solution given:12 ÷ x = 36

x=12/36=1/3 is your answer

Solve for x. Assume that lines which appear tangent are tangent.

Answers

Presumably, x is standing in for the question mark.

The pair of vertical angles (DFE and CFV) shown here both have measure 125°. This angle measure is equal to the average of the measures of the arcs intercepted by the chords CE and DV.

So we have

angle DFE = 1/2 (arc CV + arc DE)

125° = 1/2 (x + 200°)

250° = x + 200°

x = 50°

Which functions have removable discontinuities (holes)? Check all of the boxes that apply.
f(x)=x-1/x^2-1
f(x)=x^2-9/x^2+7x+12
f(x)=x^2+4x+4/x^2+2x-8
f(x)=x+7/x^2+5x-14

Answers

Answer:

A,B,D

Step-by-step explanation:

I just did it .

Answer:

It is correct, the answers are A, B and D.

Step-by-step explanation:

Edge 2021. Assignment.

A park is rectangular with a length of 2/3
miles. If the area of the park is 3/9
square miles, what is its width? Input your answer as a fraction.

Answers

Answer:

Step-by-step explanation:

let : x the width  

the area  is 2/3 ×  x  =3/9

x = (3/9)×3/2

x =1/2  miles

D is greater than E and less than C.
C and D are opposites.
At least one number is greater than A.

HELP

Answers

Answer:

?

Step-by-step explanation:

What's the exact value of tan 15°?
O A) 2 + √3
B) 1
OC2
C) 2 - V3
OD) 1 + v3

Please Help!!!!

Answers

Answer:

C

Step-by-step explanation:

Split

15

into two angles where the values of the six trigonometric functions are known.

The result can be shown in multiple forms.

Exact Form:

2−√3

The exact value of tan 15° is,

⇒ tan 15° =  - (2 - √3)

What is mean by Function?

A relation between a set of inputs having one output each is called a function. and an expression, rule, or law that defines a relationship between one variable (the independent variable) and another variable (the dependent variable).

Given that;

To find the exact value of tan 15°.

Now, We can formulate;

tan 15° = tan (45 - 30)°

          = tan 45° - tan30° / (1 + tan45° tan30°)

          = (1 - √3) / (1 + √3)

          = (1 - √3) (1 - √3) / (1 + √3) (1 - √3)

          = (1 + 3 - 2√3) / (1² - √3²)

          = (4 - 2√3) / (1 - 3)

          = 2 (2 - √3) / - 2

          = - (2 - √3)

Thus, The exact value of tan 15° is,

⇒ tan 15° =  - (2 - √3)

Learn more about the function visit:

https://brainly.com/question/11624077

#SPJ7

The length of segment GI is 8. True or false?

Answers

Answer: false

Step-by-step explanation: that’s what my teacher told me sorry if it’s wrong

Answer:

It is false

Definetely false

Please help me.
how many observations are in this data set?

Answers

Answer:

16

Step-by-step explanation:

count the dots. each is one observation

Yep it is 16 the answer

Pls help me complete this

Answers

Answer:

wow thats alot of "stuff"

Step-by-step explanation:

Answer:

For the first, top one, it is Outcome

For the second one, it is Event

For the third one, it is Trial

For the fourth one, it is Experimental Probability

For the fifth one, it is Probability

You start driving north for 8 miles, turn right, and drive east for another 6 miles. At the end of driving, what is your straight line distance from your starting point?

Answers

Answer:

I think you are asking the total distance isn't? The straight line distance from your starting point 14 miles.I've added both miles to get the total distance

Step-by-step explanation:

please if I'm wrong or my answer doesn't match the with the answer's book tell me right away I try another method.

if you have 3 cookies and your mom makes 2 dozen more and your friend tacks 15 home how many cookies do you have?

Answers

Answer:

12+12+3=27-15=12

Step-by-step explanation:

Dozen means 12. Your welcome Brainliest?

REFRESH THE PAGE lol were both here

Answer:

refresh page

Step-by-step explanation:

thing is probably being slow

If arc AB = 107° and arc BC = 122°, find the value of x.

Answers

Answer:

the value of x is acb 133°

A plane is already 44 cm tall and it will grow in one centimeter every month let H be the plants height in centimeters after M months write an equation relating H to M. Then use the equation to find a plant's height at 14 months

Answers

Answer:idea I jus wanna get my answers answered sk 3728 okay??

Step-by-step explanation:!3$:$::$2$:773727/

CAN YOU GUYS PLS HELP WHAT GOES IN EACH BOX ITS OVERDUE :( IM ABT TO FAIL WILL GIVE BRAINLIEST

Answers

Answer:

18 days.

Step-by-step explanation:

Takes 6 days to eat 1 apple so multiply 6 by three to get your answer.

Answer:

18 days

Step-by-step explanation:

since the ratio is 3 days to 1/2 that would mean 6 days is to 1 apple, so if you just multiply 6 days by 3 you would get 18 days because you would need to find how many days for 3 apples.

(1 point) Solve the following inequality, giving your answer in interval notation.
1 - x > 2

Answers

Answer:

-1

Step-by-step explanation:

1-x>2

-x>2-1

-x>1

-x/-1>1/-1

x<-1

Answer:

[tex]x < - 1[/tex]

Step-by-step explanation:

first step

try to leave x's in your left and number in your right

-x > 2-1

-x>1

step 2

by moving the sign minus to right it will become plus

and the inequality sign will change also

so x<-1

the region will ( - infinity to -1 )

[tex]( - \infty - 1)[/tex]

Can someone answer this please

Answers

Answer:

  (a)  12

Step-by-step explanation:

The integral over the reverse range is the opposite of the integral over the forward range. The integral over adjoining ranges is the integral over the whole range.

Application

  [tex]\displaystyle \int_{-1}^5{f(x)}\,dx=\int_{-1}^1{f(x)}\,dx+\int_{1}^5{f(x)}\,dx\\\\=\int_{-1}^1{f(x)}\,dx-\int_{5}^1{f(x)}\,dx=5-1=4[/tex]

Then 3 times the integral is ...

  [tex]\displaystyle 3\int_{-1}^5{f(x)}\,dx=3(4)=\boxed{12}[/tex]

Hi anyone here for talking​

Answers

Answer:

yessssssssss.........

Will give BRAINLEST :)

Answers

Answer:

A

Step-by-step explanation:

This explanation mostly depends on what you're learning right now. The first way would be to convert this matrix to a system of equations like this.

g + t + k = 90

g + 2t - k = 55

-g - t + 3k = 30

Then you solve using normal methods of substitution or elimination. It seems to me that elimination is the quickest method.

g + t + k = 90

-g - t + 3k = 30

____________

0 + 0 + 4k = 120

4k = 120

k = 30

No you can plug this into the first two equations

g + t + (30) = 90

g + t = 60

and

g + 2t - (30) = 55

g + 2t = 85

now use elimination again by multiplying the first equation by -1

g + 2t = 85

-g - t = -60

_________

0 + t = 25

t = 25

Now plug those both back into one of the equations. I'll just do the first one.

g + (25) + (30) = 90

g = 35

Therefore, we know that Ted spent the least amount of time on the computer.

The second method is using matrix reduction and getting the matrix in the row echelon form, therefore solving using the gauss jordan method. If you would like me to go through this instead, please leave a comment.

somebody please help this is due in a couple of hours :(

Answers

Answer:

Step-by-step explanation:

Tony weighs his pet turtle on a scale in his bathroom. The turtle weighs 6 1/4 ​ pounds. His turtle weighed 3 1/6 ​ pounds when he first got him. About how much more does his turtle weigh now?

Answers

3 1/12. Find the lowest common denominator. Multiply the the numerator and denominator by that. Then simplify.

1) Solve 2 + 7x + 12 = 0 using factoring and the zero product property.

a) Factor2+7x+12

b) Use the zero product property to solve for x







b) Use the zero product property to solve for x

Answers

Answer:

7x+14=0, 7x=-14, x= -2

Step-by-step explanation:

add like terms, then get x on one side, number on the other, then divide both sides by 7

Walmart is selling
school supplies: 5
notebooks only cost
$4.02! How much
would znotebooks
cost? What about 7
notebooks?
Plz help! :)

Answers

Answer:

2 notebooks are $2.48, 7 notebooks are $8.68

Step-by-step explanation:

Unit rate is 1.24

1.24x2= $2.48

1.24x7= $8.68

What is 125% of 144?

Answers

Answer:

180

hope this helps :)

144 x 125/100 = 180
................

what is the square root of

Answers

Answer:

13.42

Step-by-step explanation:

Melissa bought 2 shirts and 3 skirts and spent between $45 and $60. Each shirt costs the same amount. Each skirt costs the same amount. The price of a shirt is $12. What is the least amount Melissa could have spent on a skirt? What is the most Melissa could have spent of a skirt?

Answers

Answer:

Least is 7

Most is 12

Step-by-step explanation:

So 2 shirts for 12.

So 24

Take 24 off of both

Left with 21 to 36

21÷3 is 7

36÷3 is 12

Hope this helps

Answer:

least - $7

most - $12

Explanation:

if the price of a shirt is $12, she must have spent at least $24 on the shirts in total.

the least amount melissa could have spent on a skirt is:

($45 - $24) ÷ 3 = $7

and the most she could have spent is:

($60 - $24) ÷ 3 = $12

i hope this helps! :D

Other Questions
Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition. In which of the following instances would the independence of the CPA not be considered to be impaired? The CPA has been retained as the auditor of a brokerage firmA. Which owes the CPA audit fees for more than one year.B. In which the CPA has a large active margin account.C. In which the CPA's brother is the controller.D. Which owes the CPA audit fees for current year services and has just filed a petition for bankruptcy.