Solve:

7 (x -3)
What is the answer

Answers

Answer 1

Answer:

7x-21

Step-by-step explanation:

Answer 2
7(x-3)
7x -7 x 3
7x - 21

Related Questions

A large rectangle is made by joining three identical small rectangles as shown.

The perimeter of one small rectangle is 21cm. The width of one small rectangle is x cm.

Work out the perimeter of the large rectangle. The final line of your answer should be the form, perimeter of large rectangle is ...cm

Answers

Answer: 35 cm

Step-by-step explanation:

As shown in the image attached, the A large rectangle is made by joining three identical small rectangles,

The width of one small rectangle is x cm and the length of one small rectangle is 2x cm. Therefore the perimeter of the small rectangle is given as:

2(length + width) = Perimeter

2(2x + x) = 21

2(3x) = 21

6x = 21

x = 21/6 = 3.5 cm

x = 3.5 cm

From the image attached, the width of the large rectangle is 2x (x + x) and the length is 3x (2x + x). Therefore, the perimeter of the large rectangle is:

2(length + width) = Perimeter

2(3x + 2x) = Perimeter

Perimeter = 2(5x)

Perimeter = 10x

Perimeter = 10(3.5)

Perimeter = 35 cm

Step-by-step explanation:

The graph shows the number of hours that Tammy spends typing for work, x, and the amount of pay that she earns, y.


What is the slope of the line?

- 1 / 4

- 8 / 17

- 4

- 6

Answers

Answer: The slope of the line = 4.

Step-by-step explanation:

We know that ,

Slope of a line passes through [tex](x_1,y_1)[/tex] and [tex](x_2,y_2)[/tex]  = [tex]\dfrac{y_2-y_1}{x_2-x_1}[/tex]

Here , the line passes through points (2,18) and (8,42).

Then the slope of the given line = [tex]\dfrac{42-18}{8-2}[/tex]

[tex]=\dfrac{24}{6}=4[/tex]

Hence, the slope of the line = 4.

Answer:

4

Step-by-step explanation:

i took the test and got it right

Helpppp pleaseeeeeeee

Answers

Answer:

x= 6.85 or 89/13

Step-by-step explanation:

perimeter is sum of all sides added, so add them all and set them equal to 84

4(x-3) + 3x - 1 + 6x + 8 = 84

distribute

4x + 12 + 3x - 1 + 6x + 8 = 84

combine like terms

13x - 5 = 84

solve for x

x = 89/13 = 6.85

Thee questionn is beloww

Answers

Given:

[tex]m\angle ABC=60[/tex]

To find:

The [tex]m\angle ADC[/tex].

Solution:

In circle B, [tex]\angle ABC[/tex] is central angle and [tex]\angle ADC[/tex] is inscribed angle from two points A and C.

According to central angle theorem, central angle is always twice of inscribed angle.

[tex]m\angle ABC=2(m\angle ADC)[/tex]         [Central angle theorem]

[tex]60=2(m\angle ADC)[/tex]

Divide both sides by 2.

[tex]\dfrac{60}{2}=m\angle ADC[/tex]

[tex]30=m\angle ADC[/tex]

Therefore, [tex]m\angle ADC=30[/tex].

Which substitution method should be the best used to solve which system of equations

Answers

Answer: 6x+2y=1

Step-by-step explanation:

because it just is

Helppp pleaseeee xxxxx

Answers

Answer:

[tex] h = 3\sqrt{3} [/tex]

[tex] c = 4\sqrt{2} [/tex]

Step-by-step explanation:

✔️Finding h using trigonometric ratio:

Reference angle = 60°

Opposite = h

Adjacent = 3

Thus:

[tex] tan(60) = \frac{h}{3} [/tex]

[tex] \sqrt{3} = \frac{h}{3} [/tex] (tan 60 = √3)

Multiply both sides by 3

[tex] 3\sqrt{3} = h [/tex]

[tex] h = 3\sqrt{3} [/tex]

✔️Finding c using trigonometric ratio:

Reference angle = 45°

Hypotenuse = 8

Adjacent = c

Thus:

[tex] cos(45) = \frac{c}{8} [/tex]

[tex] \frac{\sqrt{2}}{2} = \frac{c}{8} [/tex] (cos 45 = √2/2)

Multiply both sides by 8

[tex] \frac{\sqrt{2}}{2} \times 8 = c [/tex]

[tex] \sqrt{2} \times 4 = c [/tex]

[tex] c = 4\sqrt{2} [/tex]

Calculate the length of a regular hexagon
of 62.50 cm.​

Answers

10.42
Explanation: Hope this helps!!

Nate has $50 to spend at the grocery store. he fills his shopping cart with items totaling $46 at checkout he willhave to pay 6% sales tax on all items in the cart. Does he have enough money to buy everything in his cart?

Answers

Answer:

Yes

Step-by-step explanation:

This is becuase 46 x 1.06= 48.76, thats less than $50.

Answer:

yes

Step-by-step explanation:

tax will be $2.76 therefore it will come up to $48.76

What is the inverse of the function f(x) = x +3?

Answers

1- First, replace f(x) with y

f(x) = x +3  ⇒ y = x + 3

2. Replace every x with a y and replace every y with an x .

y = x + 3 ⇒ x = y + 3

3. Solve the equation from Step 2 for y.

x = y + 3  ⇒ y = x-3

4 - Replace y with f⁻¹(x).

f⁻¹(x) = x-3

The inverse is f⁻¹(x) = x-3

3/5+(-7/5)= can someone help me with this please

Answers

Answer:

[tex]-\frac{4}{5}[/tex]

Step-by-step explanation:

Because both of the fractions have a common denominator they can be subracted without any other work.

unit rate of 122 and 10 please

Answers

The unit rate is 4.72 times re amount of phechel matter there is

What is the only number that is a factor of every number?
A.5
B.2
C.1
D. 3.54

Answers

The only number that is a factor of every number is : 1

Answer:

the answer of the question is c.1

Solve for n.
below
.....................

Answers

Subtract 8 from both sides
-n = -12
Divide by -1
Solution: n = 12

Answer:

n = 12

I hope this helps!

Find the indicated probability.
If P(A or B) = 0.8, P(A) = 0.4, and P(A and B)= 0.15, find P(B).
P(B)=
(Simplify your answer. Type an integer or a decimal.)

Answers

Answer:

[tex]P(B) = 0.55[/tex]

Step-by-step explanation:

Given

[tex]P(A\ or\ B) = 0.8[/tex]

[tex]P(A) = 0.4[/tex]

[tex]P(A\ and\ B) = 0.15[/tex]

Required

Find P(B)

In probability, we have:

[tex]P(A\ or\ B) = P(A) + P(B) - P(A\ sd B)[/tex]

Substitute values

[tex]0.8 = 0.4 + P(B) - 0.15[/tex]

Collect Like Terms

[tex]P(B) = 0.8 - 0.4 + 0.15[/tex]

[tex]P(B) = 0.55[/tex]

Mr.Farrar spent a total of $43.87 after tax on new clothes at a clothing store. He brought 1 pair of sandals for $8.02 t-shirts fo $9.49 each and 1 pair of jeans. The tax on the purchase was $2.87 how much did Mr.Farrar pay for the pair of jeans?

Answers

Answer:

43.87 - 8 = 35.87  (sandals)

9.49 + 9.49 = 18.98 ( for two t-shirts)

35.87 - 18.98 = 16.89 (t-shirts)

16.89 - 2.87 = 14.02 (taxes)

Andrea payed $14.02 for a pair of jeans

Hopes this helps you!

Step-by-step explanation:


A company that makes hair care products had 9,000 people try a new shampoo. Of the 9,000 people,
18 had a mild allergic reaction. What percent of the people had a mild allergic reaction?

Answers

Answer:

0.2%

Step-by-step explanation:

18/9000×100%

now use calculator

Answer: 0.2 percent

Step-by-step explanation:

This is the number of people who were allergic to the shampoo/ total people

18/9000

Simplify!

1/500=0.02=0.2 percent of people


I need help with this

Answers

Answer:

A.

Step-by-step explanation:

I gotchu fam. The first thing that you would want to do is find the slope. The slope is the change in y divided by the change in x. Based on the points on the line, the change in y is 2 because it goes up two, and the change in x is one because it goes over 1. This would make your slope 2/1, or just 2! Now we have our slope, so we want to find our y-intercept. There are two ways that we can do this. The first way is just eyeballing it, but sometimes that's not always accurate. We're just going to do that because its faster (lol). It looks around -2. With this information, we have our entire equation! y=mx+b. we can plug in our information. y=2x-2. And that's how your answer's A! Hope this helps.

How many natural numbers are between 34 and 72? and, how many whole numbers between -2 and 25?

Answers

Answer:

There are 37 natural numbers between 34 and 72.

There are 25 whole numbers between -2 and 25.

Step-by-step explanation:

1. Natural numbers between 34 and 72

2. Whole numbers between -2 and 25

1.35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71.

2.0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24.

Find the size of the angle 2 x

Answers

Answer:

Given - Angles measure 2x , X and 3x

To find - Measures of 2x

Solution -

2x + X = 180° ( forming linear pair )

3x = 180°

x = 180/3

x = 60°

2x = 2 × 60 = 120°

Answer:

120°

plz give brainlist

Step-by-step explanation:

since 2x and x form a straight angle you get the equation

2x + x = 180

combine like terms

3x = 180

devide by 3

x = 60

evaluate 2x

2(60) = 120

A salesperson at a jewelry store earns ​5% commission each week. Last​ week, Heidi sold 640 worth of jewelry. How much did Heidi make in​ commission? How much did the jewelry store make from ​sales?

Answers

Answer:

12,800 Dollars USD

Step-by-step explanation:

9 × ( 6+ 11 ) = (9 6) (9 11)​

Answers

assuming the 9 6 and 9 11 are fractions, we get:

9 x ( 6 + 11 ) = (9/6) (9/11)​ =

153 = 27/22

Answer:

9(17) = (9 x 6)+(9 x 11)

153 = 54 + 99

153 = 153

Hope this helped! If it did, please give me brainliest! It would help a lot! Thanks! :D

Express as a fraction or a mixed number
1 1/2%

Answers

Answer:

5 and 1/2

Step-by-step explanation:

At Barlow school, 4/9 of the 873 students are boys. At Willow school, 2/3 of the 630 students are girls
Which school has a greater of boys and how many?

Answers

Answer:

I have attached the answer

Is 5/12 closer to 0, 1, 1/2

Answers

Answer:

1/2

Step-by-step explanation:

Answer:

1/2

Step-by-step explanation:

1/2 is 6/12. 6/12 is close to 5/12 than the others.

Perform the following operation
and express the answer in
scientific notation.
6.300x10^-5 – 7.200x10^-3

[?]*10

Answers

Answer:

Step-by-step explanation:

6.3 x10^-5 -7.200 x10^-3= - 0.007137=7.137x10-3

Answer:-7.137 x 10^-3

Step-by-step explanation:

Lucy $154 made for 11 hours of work. At the same rate, how much would she make for 8 hours of work?

Answers

Answer:

19.25

Step-by-step explanation:

I need help right now brain listed if somone helps me!​

Answers

Answer:

6/5

Step-by-step explanation:

Remember:  to divide a number by a fraction, invert the fraction and multiply.

Here "the number" is 4/5 and you want to divide it by 2/3.  Invert the '2/3', obtaining 3/2, and then multiply the '4/5" by '3/2":

12/10 = 6/5 (answer)

Find the LCM of the denominators in these fractions
5/6 and 1/14

Answers

Answer:

35/42 and 3/42

Step-by-step explanation:

Multiply by 3.

HOPE THIS HELPS :)

The LCM of the denominators in the fractions 5/6 and 1/14 is 42.

What is Least Common Multiple(LCM)?

The least common multiple is defined as the least positive integer that is dividable by both given numbers.

A group's Least Common Multiple (LCM) is the smallest number that is a multiple of all the numbers.

To find the least common multiple (LCM) of two numbers, you can list the multiples of each number and find the smallest number that is a multiple of both.

The multiples of 6 are 6, 12, 18, 24, 30, and so on. The multiples of 14 are 14, 28, 42, 56, and so on. The smallest number that is a multiple of both 6 and 14 is 42, so the LCM of 6 and 14 is 42.

Therefore, the denominators in the fractions 5/6 and 1/14 have an LCM of 42.

To learn more about the Least Common Multiple(LCM) here :

https://brainly.com/question/17256135

#SPJ2

What is the range of h

Answers

“B” is the answer I think

A pipe is leaking in the school bathroom . it leaked 3 gallons of water in 6 hours.
Find the constant of proportionality

Answers

Answer:

0.5 gallons per hour

Step-by-step explanation:

Other Questions
what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ...........