Suppose currently Samsung's common stock is selling for $216. The company announced that it will give $1.14 dividend next year and it plans to grow the dividend by 5% every year. Given the information what is the market's required rate of return for the stock? (Round your answer to two decimal points)

Answers

Answer 1

The market's required rate of return for Samsung's common stock is 5.53%, rounded to two decimal points

What is meant by the rate of stock?

The rate of stock refers to the price at which a particular stock is being bought or sold in the stock market, which can vary based on supply and demand.

What is decimal?

A decimal is a number system that uses the base 10 and includes a decimal point to separate the integer part from the fractional part. It is commonly used in mathematics and everyday life for expressing fractions, percentages, and monetary values.

According to the given information

We can use the constant-growth dividend discount model to calculate the market's required rate of return for the stock. The model is:

Current stock price = Dividend next year / (Required rate of return - Dividend growth rate)

We know the current stock price is $216, the dividend next year is $1.14, and the dividend growth rate is 5%. We need to solve for the required rate of return.

216 = 1.14 / (r - 0.05)

Multiplying both sides by (r - 0.05), we get:

216(r - 0.05) = 1.14

Expanding the left side, we get:

216r - 10.8 = 1.14

Adding 10.8 to both sides, we get:

216r = 11.94

Dividing both sides by 216, we get:

r = 0.0553 or 5.53%

Therefore, the market's required rate of return for Samsung's common stock is 5.53%, rounded to two decimal points

To know more about decimal visit

brainly.com/question/30958821

#SPJ1

Answer 2

The market's required rate of return for Samsung's common stock is 5.53%, rounded to two decimal points

What is meant by the rate of stock?

The rate of stock refers to the price at which a particular stock is being bought or sold in the stock market, which can vary based on supply and demand.

What is decimal?

A decimal is a number system that uses the base 10 and includes a decimal point to separate the integer part from the fractional part. It is commonly used in mathematics and everyday life for expressing fractions, percentages, and monetary values.

According to the given information

We can use the constant-growth dividend discount model to calculate the market's required rate of return for the stock. The model is:

Current stock price = Dividend next year / (Required rate of return - Dividend growth rate)

We know the current stock price is $216, the dividend next year is $1.14, and the dividend growth rate is 5%. We need to solve for the required rate of return.

216 = 1.14 / (r - 0.05)

Multiplying both sides by (r - 0.05), we get:

216(r - 0.05) = 1.14

Expanding the left side, we get:

216r - 10.8 = 1.14

Adding 10.8 to both sides, we get:

216r = 11.94

Dividing both sides by 216, we get:

r = 0.0553 or 5.53%

Therefore, the market's required rate of return for Samsung's common stock is 5.53%, rounded to two decimal points

To know more about decimal visit

brainly.com/question/30958821

#SPJ1


Related Questions

Danielle likes to purchase items at estate sales, clean them up, then resale them online for a profit. She recently purchased an antique dresser with a mirror at an estate sale, cleaned it up, and advertised it for 250% of her purchase price. Danielle sold the dresser for $255, which was 15% less than the advertised price.
To the nearest whole dollar, how much did Danielle purchase the antique dresser for and what was her initial advertised price?

A. purchase price: $120, advertised price: $300
B. purchase price: $108, advertised price: $270
C. purchase price: $130, advertised price: $325
D. purchase price: $117, advertised price: $293

Answers

Answer:

The correct answer is D. purchase price: $117, advertised price: $293.

Step-by-step explanation:

Find the surface area of a cube with edges 6.44 cm long.

Answers

Answer:

Step-by-step explanation:

The surface area of a cube is given by the formula:

SA = 6s^2

where s is the length of an edge.

Substituting s = 6.44 cm into the formula, we get:

SA = 6(6.44 cm)^2

SA = 6(41.4736 cm^2)

SA = 248.8416 cm^2

Therefore, the surface area of the cube is 248.8416 cm^2.

Calculator The diameter of a ball is 9 in. What is the volume of the ball? Use 3.14 for pi. Enter your answer as a decimal in the box. Round only your final answer to the nearest hundredth. in³ ​

Answers

To find the volume of a ball, we use the formula V = (4/3)πr³, where r is the radius of the ball. We are given the diameter of the ball, which is 9 inches.

The radius of the ball is half of the diameter, so

r = 9/2 = 4.5 inches.

Substituting this value of r in the formula, we get:

V = (4/3)π(4.5)³V = (4/3)π(91.125)V = 4.1888 × 91.125V ≈ 381.71

Therefore, the volume of the ball is approximately 381.71 cubic inches.

When rounded to the nearest hundredth, the answer is 381.71.

For such more question on diameter

https://brainly.com/question/28162977

#SPJ8

A data set of the least purchased menu items at a bakery is best shown as a _____

Answers

Answer:

A data set of the least purchased menu items at a bakery is best shown as a (Report)

Step-by-step explanation:

Have A Good Day :)

help qiuckly math homework

Answers

Angle or arc HGJ is measured at 275 for given figure.

What does arc of circle stands for?

Arcs may be created from the circumference of a circle. It is referred to as the curved line that connects two locations on a circle's perimeter and splits it into segments. The length of an arc is inversely proportional to the angle it makes at the centre of the circle.

When the central angle rises, so does the arc's length, and vice versa. Arcs are commonly used to depict and compute measurements of circles and circular objects in geometry, trigonometry, and physics.

For given problem,

mHGJ= 360° - mJH = 360°-( mJl + mlH ) =  360°-(30°+55°)

         = 360°-85° = 275°

Hence, arc or angle HGJ= 275 degrees

Learn more about Arcs here:

brainly.com/question/18741430

#SPJ1

A(n) __________ is an amount returned after purchase or deducted from the purchase price.

Answers

Step-by-step explanation:

A(n) discount is an amount returned after purchase or deducted from the purchase price.

Please help stuck on this question!

Answers

Answer:

Step-by-step explanation:

To solve this problem, we need to use the distance formula to find the length of each side of the triangle, and then apply the Pythagorean theorem to determine whether the triangle is a right triangle.

Let's label the three vertices of the triangle as A, B, and C, and their coordinates as follows:

A = (-2, 5)

B = (3, -1)

C = (1, 3)

The length of AB is:

AB = sqrt((3 - (-2))^2 + (-1 - 5)^2) = sqrt(25 + 36) = sqrt(61)

The length of AC is:

AC = sqrt((1 - (-2))^2 + (3 - 5)^2) = sqrt(9 + 4) = sqrt(13)

The length of BC is:

BC = sqrt((1 - 3)^2 + (3 - (-1))^2) = sqrt(4 + 16) = sqrt(20) = 2sqrt(5)

Now, we need to check whether the triangle is a right triangle. We can do this by checking whether the sum of the squares of the two shorter sides (AB and AC) is equal to the square of the longest side (BC). If it is, then the triangle is a right triangle.

AB^2 + AC^2 = 61 + 13 = 74

BC^2 = (2sqrt(5))^2 = 20

Since AB^2 + AC^2 is not equal to BC^2, the triangle is not a right triangle.

Therefore, the answer is: "The triangle is not a right triangle."

Indirect measurement, pls help, I am stuck on this question.

Answers

The building is, 246 feet tall.

Since, We know that;

Two or more triangles will always be referred to as similar if on comparing their corresponding properties, some common relations holds. Some of the relations are relations between their length of sides, relations among their internal angles etc.

To determine the height of the building, we have;

height of pole = 7 ft

total length of the building's shadow = 167 ft

the length of the shadow of the pole = 4.75 ft

Let the height of the building be represented by h. On comparison, we have;

4.75/ 167 = 7/h

4.75h = 167 x 7

        = 1169

h = 1169/ 4.75

h  = 246.11

Hence, The building is 246 ft. tall.

Learn more about similar triangles at;

brainly.com/question/21140865

#SPJ1

A pool measuring 18 meters by 30 meters is surrounded by a path of uniform width, as shown in the
figure. If the area of the pool and the path combined is 1900 square meters, what is the width of
the path?

Answers

Answer: 3 meters

Step-by-step explanation:

The area of the rectangular region is given by:

(18 + 2x) * (30 + 2x) = 18*30 + 36x + 60x + 4x^2

Simplifying this expression, we get:

4x^2 + 96x - 1300 = 0

Dividing both sides by 4, we get:

x^2 + 24x - 325 = 0

Now we can solve for x using the quadratic formula:

x = (-b ± sqrt(b^2 - 4ac)) / 2a

where a = 1, b = 24, and c = -325.

Plugging in these values, we get:

x = (-24 ± sqrt(24^2 - 4(1)(-325))) / 2(1)

x = (-24 ± sqrt(936)) / 2

x = (-24 ± 30) / 2

x = 3 or -27

Since the width of the path cannot be negative, the only possible solution is x = 3 meters. Therefore, the width of the path surrounding the pool is 3 meters.

what us the rate of change in the value of one share of company’s stock, in dollars per day, from Day 0 to Day 15

Answers

Check the picture below.

the slope goes by several names

• average rate of change

• rate of change

• deltaY over deltaX

• Δy over Δx

• rise over run

• gradient

• constant of proportionality

however, is the same cat wearing different costumes.

[tex]\begin{array}{llll} f(x)~from\\\\ x_1 ~~ to ~~ x_2 \end{array}~\hfill slope = m \implies \cfrac{ \stackrel{rise}{f(x_2) - f(x_1)}}{ \underset{run}{x_2 - x_1}}\impliedby \begin{array}{llll} average~rate\\ of~change \end{array} \\\\[-0.35em] ~\dotfill\\\\ \begin{cases} x_1=0\\ x_2=15 \end{cases}\implies \cfrac{f(15)-f(0)}{15 - 0}\implies \cfrac{11-5}{15}\implies \cfrac{6}{15}\implies \cfrac{2}{5}[/tex]

What is the end behavior of the function f of x equals negative 2 times the cube root of x?

What is the end behavior of the function f of x equals negative 2 times the cube root of x?

As x → –∞, f(x) → 0, and as x → ∞, f(x) → 0.
As x → 0, f(x) → –∞, and as x → ∞, f(x) → 0.
As x → ∞, f(x) → ∞, and as x → –∞, f(x) → –∞.
As x → –∞, f(x) → ∞, and as x → ∞, f(x) → –∞.

Answers

The end behavior of the given function is As x → –∞, f(x) → –∞, and as x → ∞, f(x) → –∞.

What is end behavior of function?

The term "end behavior" describes the behaviour or trend of a function's graph as its x-values go closer to positive or negative infinity. It explains how the function "ends" or acts when x is extremely large (positive infinity) or extremely small (negative infinity). The degree and leading coefficient of the polynomial formulation of the function can be used to predict the final behaviour. For instance, the left and right ends of the graph will both point upward for a function with an odd-degree polynomial and a positive leading coefficient (towards positive infinity).

For the function f(x) = -2∛x as x approaches negative infinity because the function has a negative coefficient in front of the cube root, which means that as x decreases significantly, the absolute value of the cube root increases. The function also approaches negative infinity as x approaches very big (positive) values and the cube root approaches very small absolute values. As a result, the function's final behaviour is that it approaches negative infinity as x gets closer to both negative and positive infinity.

Learn more about end behavior here:

https://brainly.com/question/29036038

#SPJ1

The end behavior of the given function is As x → –∞, f(x) → –∞, and as x → ∞, f(x) → –∞.

What is end behavior of function?

The term "end behavior" describes the behaviour or trend of a function's graph as its x-values go closer to positive or negative infinity. It explains how the function "ends" or acts when x is extremely large (positive infinity) or extremely small (negative infinity). The degree and leading coefficient of the polynomial formulation of the function can be used to predict the final behaviour. For instance, the left and right ends of the graph will both point upward for a function with an odd-degree polynomial and a positive leading coefficient (towards positive infinity).

For the function f(x) = -2∛x as x approaches negative infinity because the function has a negative coefficient in front of the cube root, which means that as x decreases significantly, the absolute value of the cube root increases. The function also approaches negative infinity as x approaches very big (positive) values and the cube root approaches very small absolute values. As a result, the function's final behaviour is that it approaches negative infinity as x gets closer to both negative and positive infinity.

Learn more about end behavior here:

https://brainly.com/question/29036038

#SPJ1

Answer:

The function f(x) = -2∛x represents a cube root function that is multiplied by -2.

As x approaches negative infinity, the cube root of x becomes more negative, and when it is multiplied by -2, it becomes more positive. Therefore, as x → –∞, f(x) → ∞.

As x approaches positive infinity, the cube root of x becomes more positive, and when it is multiplied by -2, it becomes more negative. Therefore, as x → ∞, f(x) → –∞.

Therefore, the correct answer is: As x → –∞, f(x) → ∞, and as x → ∞, f(x) → –∞. D.

Answer:

The function f(x) = -2∛x represents a cube root function that is multiplied by -2.

As x approaches negative infinity, the cube root of x becomes more negative, and when it is multiplied by -2, it becomes more positive. Therefore, as x → –∞, f(x) → ∞.

As x approaches positive infinity, the cube root of x becomes more positive, and when it is multiplied by -2, it becomes more negative. Therefore, as x → ∞, f(x) → –∞.

Therefore, the correct answer is: As x → –∞, f(x) → ∞, and as x → ∞, f(x) → –∞. D.

What kinda transformations does this make y=3^(x-2)-4

Answers

The function is transformed by horizontal translation to the right is applied first, followed by the vertical translation downward

Given data ,

Let the parent function be represented as f ( x )

Now , the value of f ( x ) is

y = 3ˣ

Let the transformed function be f' ( x )

y' = 3⁽ˣ⁻²⁾ - 4

Horizontal Translation: When compared to the basic function, y = 3x, the function's "(x-2)" inside the exponent of 3 causes a horizontal translation to the right of 2 units.

This results in a 2 unit shift along the x-axis of the function's graph.

Vertical Translation: In comparison to the base function y = 3x, the "-4" at the end of the function causes a vertical translation downward of 4 units.

This results in a 4 unit downward shift of the function's y-axis graph.

Hence , the function is transformed

To learn more about transformation of functions click :

https://brainly.com/question/26896273

#SPJ1

Determine the volume of the "leaning" regular hexagonal prism.
It has a base perimeter of 36 inches, a slanted height of 11 inches, and is leaning at
70°. The base is a regular hexagon with a perimeter of 36 inches.
6.70%
11"

Answers

The volume of the leaning regular hexagonal prism, can be found to be 351. 89 inch ³.

How to find the volume ?

A right triangle can be constructed in a regular hexagon by linking the midpoint of one side and a vertex to the center. This specially-crafted triangle comprises two legs, one of which is half the size of the primary side (acting as the hypotenuse) while the remaining leg lies parallel to the hexagon's apothem (height).

The height of the prism can be found with cosine to be:

h = slanted height x Cos (angle )

h = 11 x Cos ( 70 degrees )

h = 3. 762 inches

We can then find the volume of the leaning hexagonal prism to be:

= Area x Height

= 93. 528 x 3. 762

= 351. 89 inch ³

Find out more on volume at https://brainly.com/question/23104005

#SPJ1

Consider the quadratic equation x2 + 9x + 10 = 0. Which of the following is the correct form after substituting a, b, and c into the
Quadratic Formula?

Answers

Given a quadratic in the form ax^2+bx+c=0. We can use the quadratic equation to solve for the values of x. Where the quadratic eqauation is written as (-b±√(b^2-4ac))/2a.

Given the quadratic equation x^2+9+10=0 our coefficients are as follows….
a=1
b=9
c=10

Plugging these into the quadratic formula we get,

(-(9)±√((9)^2-4(1)(10)))/2(1)

Thus, the proper set up is the SECOND OPTION.

Hello everyone please Can u help

Answers

Answer:

the second one is x= -1

*this stuff is genuinely easy. I'm in 10th grade and all you have to do is put it in the calculator. If you have a tinspire like me you could make the x into a 1 in the calculator, put the whole thing in graph and it'll trace the answer for you. If your teacher wants to see work then maybe don't do that but let me know and I'll send the work for you.

Planes T and X are parallel. Plane T contains line a. Plane X contains line b.

Planes T and X are parallel. Plane T contains line a and plane X contains line b.

Answers

Answer:

Step-by-step explanation:

1

In triangle ABC, a=6, b=7, and cos C=1/4 A.) Find the exact area of the triangle. B.) Find C C.) Find sin A in simplest radical form.

Answers

A.) Area = (1/2) × 7 × 6 × √(15)/4 = 21√(15)/4

B.) Angle C is 75 degrees.

C.) Sin(A) is 3√(255)/85 in simplest radical form.

What is trigonometry?

Trigonometry is a branch of mathematics that examines triangle-related relationships and calculations, particularly the measurement of triangle sides and angles.

A.) We can apply the following formula to determine the triangle's area:

Area = (1/2) × b × a × sin(C)

Since we know b=7 and a=6, we have:

Area = (1/2) × 7 × 6 × sin(C)

To find sin(C), we can use the fact that cos(C) = 1/4 and the Pythagorean identity:

sin²(C) + cos²(C) = 1

sin(C) = √(1 - cos²(C)) = √(1 - 1/16) = √(15/16) = √(15)/4

B.) To find C, we can use the Law of Cosines:

c² = a² + b² - 2ab×cos(C)

c² = 6² + 7² - 2(6)(7)(1/4) = 85/2

c = √(85)/2

Now we can use the Law of Cosines again to find angle C:

cos(C) = (a² + b² - c²)/(2ab)

cos(C) = (6² + 7² - (√(85)/2)²)/(267) = 1/4

C.) To find sin(A), we can use the Law of Sines:

sin(A)/a = sin(C)/c

sin(A) = asin(C)/c = 6(√(15)/4)/(√(85)/2) = 3×√(15)/√(85) = √(255)/85

To know more about simplest radical form visit:

https://brainly.com/question/565192

#SPJ1

adam bought a skateboard that is on sale for 35% off. the original cost is $150. what is the sale price? show your work

Answers

Answer:

$97.50

Step-by-step explanation:

Purchase Price:

$150

Discount:

(150 x 35)/100 = $52.50

Final Price:

150 - 52.50 = $97.50

Solve the system using the method of your choice.
3x+y=−12x−y=−8

Answers

Answer: x=-5,y=3

Step-by-step explanation: Add the 2 equations together, 3x+x=4x, y+(-y)=0, and -12-8=-20. This leaves us with 4x=-20, so x=-5. Plug x back into the equation, so -5-y=-8, add 5 to both sides  so -y=-3, and y=3.

Hailey goes to a store an buys an item that costs a dollars. She has a coupon for 35%
off, and then a 8% tax is added to the discounted price. Write an expression in terms
of a that represents the total amount that Hailey paid at the register.

Answers

Hailey goes to a store an buys an item that price of a dollars, so the expression that represents the total amount that Hailey paid at the register in terms of a is 0.702a.

The amount of discount that Hailey receives is 35% of the original price, which is 0.35a. Therefore, the discounted price she pays is a - 0.35a = 0.65a.

The amount of tax that is added to the discounted price is 8% of the discounted price, which is 0.08(0.65a) = 0.052a.

So the total amount that Hailey paid at the register is the discounted price plus the tax:

total amount = discounted price + tax

total amount = 0.65a + 0.052a

Simplifying this expression, we get:

total amount = 0.702a

Therefore, the expression that represents the total amount that Hailey paid at the register in terms of a is 0.702a.

For more details regarding tax, visit:

https://brainly.com/question/16423331

#SPJ1

What is the solution to the following system of equations?

4x + 2y = 18
x − y = 3

(−4, −1)
(1, 4)
(−1, −4)
(4, 1)
pls help me​

Answers

The solution to the system of equations is (4, 1).

2. Write an equation that
gives your own "recipe" for
making a skateboard.

Answers

The equation is Skateboard = Deck + Grip Tape + Trucks + Wheels + Bearings + Hardware + Assembly + Personalization.

What is the equation for making a skateboard?

Here's an equation that outlines my "recipe" for making a skateboard:

Skateboard = Deck + Grip Tape + Trucks + Wheels + Bearings + Hardware + Assembly + Personalization

Explanation of the equation:

Deck: The wooden or composite board that serves as the main body of the skateboard. It is typically made from layers of plywood or other materials, and its dimensions (length, width, concavity, etc.) can be customized based on personal preference.

Grip Tape: A sandpaper-like material that is applied to the top of the deck to provide traction for the rider's feet. It is usually made of adhesive-backed paper or fabric and comes in various designs and colors.

Trucks: Metal T-shaped components that are mounted on the underside of the deck and serve as the axle and suspension system of the skateboard. They consist of a baseplate, hanger, kingpin, bushings, and hardware, and are responsible for allowing the board to turn and pivot.

Wheels: Typically made of urethane or other durable materials, skateboard wheels come in various sizes, shapes, and hardness levels (durometer). They are attached to the trucks and provide smooth rolling and maneuverability.

Bearings: Small, round metal or ceramic components that fit inside the wheels and allow them to spin freely on the axle. They are crucial for reducing friction and enabling the wheels to roll smoothly.

Hardware: Nuts, bolts, and screws used to attach the trucks to the deck and assemble the skateboard. They are typically made of metal and come in different sizes and lengths.

Assembly: The process of putting together all the skateboard components to create a functional skateboard. It involves attaching the trucks to the deck using the hardware, installing the wheels and bearings, and applying the grip tape.

Personalization: This refers to any additional customization or personal touches that a skateboarder may choose to add to their skateboard, such as stickers, artwork, or modifications to the deck shape or truck settings, to make it unique and suited to their individual style.

Learn more about equation here: https://brainly.com/question/31336228

#SPJ1

Quadrilateral CDEF is inscribed in circle A.


If m∠CFE = (2x + 6)° and m∠CDE = (2x − 2)°, what is the value of x?


22

44

46

89

Answers

The quadrilateral is inscribed inside the circle and x = 44

Given data ,

Let the quadrilateral be inscribed inside the circle as shown in the figure

Now , the measure of angles are

m∠CFE = (2x + 6)°

m∠CDE = (2x − 2)°

And , opposite sides of the angles of quadrilateral are supplementary

So , m∠CFE + m∠CDE = 180°

On simplifying , we get

2x + 6 + 2x - 2 = 180

4x + 4 = 180

4x = 176

x = 44

Hence , the angle is solved and x = 44

To learn more about circle click :

https://brainly.com/question/28391204

#SPJ1

The complete question is attached below :

Quadrilateral CDEF is inscribed in circle A.

If m∠CFE = (2x + 6)° and m∠CDE = (2x − 2)°, what is the value of x?

A) 22

B) 44

C) 46

D) 89

Answer: 44

Step-by-step explanation:

i took the test

A triangle plot of land has one side along a straight road measuring 324 feet. A second side makes a 68Degree angle with the road and the third side makes a 54 degree angle with the road. How long are the other two sides?

Answers

The missing dimensions of the triangular plot of land are:

i. b = 2.45

ii. A = 69.5

iii. C = 75.5^o

What is a cosine rule?

A cosine rule is a trigonometric function that can be used to determine the length of side, or measure of the internal angles of a none right angled triangle.

Cosine rule states that;

[tex]b^{2}[/tex] = [tex]a^{2}[/tex] + [tex]c^{2}[/tex] -2acCos B

To determine the missing values of the triangle in the attached diagram, we have;

[tex]b^{2}[/tex] = [tex]a^{2}[/tex] + [tex]c^{2}[/tex] -2acCos B

  = 4^2 + 7^2 - 2(4*7)Cos35^o

  = 16 + 49 -2(36*0.8192)

  = 65 - 58.9824

  = 6.0176

b = (6.0176)^1/2

  = 2.4531

b = 2.45

From sine rule,

a/ Sin A = b/Sin B = c/ Sin C

a/ Sin A = b/Sin B

4/Sin A = 2.45/ Sin 35

Sin A = 4* Sin 35/ 2.45

        = 0.9365

A = Sin^-1 0.9365

  = 69.47

A = 69.5

So to determine the value of C, we have;

A + B + C = 180^o

69.5 + 35 + C = 180

104.5 + C = 180

C = 180 - 104.5

   = 75.5

C = 75.5^o

Learn more about the cosine rule at https://brainly.com/question/30717680

#SPJ1

a rectangle has a perimeter of 48 in. the length and width are scaled by a factor of 2.5. what is the perimeter of the resulting rectangle?​

Answers

The calculated value of the perimeter of the scaled rectangle is 120 inches

Calculating the perimeter of the scaled rectangle

From the question, we have the following parameters that can be used in our computation:

Perimeter =  48 in

Scale factor = 2.5

Using the above as a guide, we have the following:

Perimeter of the scaled rectangle = Perimeter * Scale factor

Substitute the known values in the above equation

Perimeter of the scaled rectangle = 48 * 2.5

Evaluate

Perimeter of the scaled rectangle = 120

Hence, the perimeter of the scaled rectangle is 120


Read more about scale factor at

https://brainly.com/question/29229124

#SPJ1

Math:
Please very urgent, I’ll give brainliest if it’s correct

(a) [2 marks] The function
p(t) = 20 sin 360t + 100 models a
person's blood pressure while resting, where p(t) represents the blood pressure, in millimeters of mercury, and t is the time, in seconds. Sketch a graph of this function for 0 (b) [2 marks] Find the period of the function in part {a), and describe what the period represents.
(c) [4 marks] The function
p(t) = 20 sin 720t + 100 models a
person's blood pressure while exercising.
Sketch a graph of this function for 0 < t < 3.
(d) [2 marks] Find the period of the function in part (c), and describe what the period represents.
(e) [2 marks] Find the amplitude of each function, and describe what the amplitude represents.

Answers

(a) The graph is a sine curve with amplitude 20, period 1, and vertical shift 100. At t=0, the blood pressure is 100 mmHg. The graph oscillates between a minimum of 80 mmHg and a maximum of 120 mmHg.

(b) The period is 1 second, which represents the time it takes for one complete cycle of the sine wave. In this case, it represents the time it takes for the blood pressure to go through one complete cycle (from minimum to maximum to minimum again).

(c) The graph is a sine curve with amplitude 20, period 1/2, and vertical shift 100. At t=0, the blood pressure is 100 mmHg. The graph oscillates between a minimum of 80 mmHg and a maximum of 120 mmHg.

(d) The period is 1/2 second, which represents the time it takes for one complete cycle of the sine wave. In this case, it represents the time it takes for the blood pressure to go through one complete cycle (from minimum to maximum to minimum again).

(e) The amplitude of each function is 20, which represents half the difference between the maximum and minimum blood pressure.

Convert 8 5/8 to a decimal. Show your work.

Answers

Answer: 8.625

Step-by-step explanation:The eight stays an 8 snd 5:8 is .625. Add these together and you get 8.625.

suppose you want to double the area of the patio shown at the right. find the increase x of both the length and width of the patio

Answers

The New Area based on the information will be 168ft

How to calculate the area

Expanding the above equation, we get:

120ft² + 22x + x² = 240ft²

Rearranging and simplifying, we get:

x² + 22x - 120 = 0

Since the increase cannot be negative, we take the positive value of x:

x = 2

Therefore, the increase in both the length and width of the patio should be 2ft to double its area.

New Length = 10ft + 2ft = 12ft

New Width = 12ft + 2ft = 14ft

New Area = 12ft x 14ft = 168ft²

Learn more about area on

https://brainly.com/question/25292087

#SPJ1

Writing a function rule given a table of ordered pairs. A table of values of a linear function is shown below. Find the output when the input is n. Type your answer in the space provided.

Answers

The output for an input of n is given as follows:

f(n) = -4 - 2n.

How to define a linear function?

The slope-intercept representation of a linear function is given by the equation presented as follows:

y = mx + b

The coefficients of the function and their meaning are described as follows:

m is the slope of the function, representing the change in the output variable y when the input variable x is increased by one.b is the y-intercept of the function, which is the initial value of the function, i.e., the numeric value of the function when the input variable x assumes a value of 0. On a graph, it is the value of y when the graph of the function crosses the y-axis.

For this problem, we have that when x increases by one, y decays by two, hence the slope m is given as follows:

m = -2.

Hence:

f(n) = -2n + b.

When n = 1, f(n) = -6, hence the intercept b is obtained as follows:

-6 = -2 + b

b = -4.

Hence the equation is:

f(n) = -2n - 4.

More can be learned about linear functions at https://brainly.com/question/24808124

#SPJ1

Help math homework will brainlist

Answers

Answer:

? = 13.7

Step-by-step explanation:

Right triangle equation A^2 + B^2 = C^2

7.6^2 + 11.4^2 =

57.76 + 129.96 = 187.72


find the square root of 187.72 by putting it in the calculator

187.72 = 13.70109485^2

Estimate = 13.7^2

Other Questions
pt.2 Can somebody do this, please?! 10. describe three similarities between mitosis and meiosis. a. 11. describe three ways the outcome of mitosis and meiosis differ. a first order reaction has a rate constant of 1.10 x 10-4 s-1 at 470oc, and 5.70 x 10-4 s-1 at 500oc. what is the activation energy for the reaction?a. 260 kJ/mol b. 46 kJ/mo c. 110 kJ/mol d. 380 kJ/mol The French experience in New France was similar to the Spanish experience in New Mexico in all of the following ways, EXCEPT...Group of answer choicesImperial influence was expanded by conquering native peoplesLow level immigrationDependence upon the native peoplesInter-racial marrying and social integration Express cos M as a fraction in simplest terms. Multiple energy storage methods are in use around the world. Pumped hydroelectric is a common energy storage method in the United States that pumpswater into a storage pond raised above another water source and then allows the water to flow downhill through a turbine to generate electricity. How is theenergy stored in pumped hydroelectric facilities?O as kinetic rotational energyO as stored chemical energyO as thermal energyO as gravitational potential energy When light enters and leaves the prism, its path is changes because the light is _____ at the boundary between the glass and the airA. Absorbed B. DiffractedC. ReflectedD. Refracted Sheridan Company is considering an investment that will return a lump sum of $929,000 6 years from now. CWhat amount should Sheridan Company pay for this investment to earn an 8% return? (Round answer to 2 decimal places, eg. 25.25.)Lincoln Company should pay $ ___Wildhorse Co.earns 8% on an investment that pays back $87,000 at the end of each of the next 6 years.What is the amount Wildhorse Co. invested to earn the 8% rate of return? (Round answer to 2 decimal places, eg. 5,275.25.) Wildhorse Co. invested $ ___ compare and contrast the expansionist policies of the russian state with those pursued by the british and french regimes during this period. let x have the following cumulative distribution function (cdf): f(x)={0,x Gary deposited $9,000 in a savings account with simple interest. Four months later, he had earned $180 in interest. What was the interest rat (conservation of mass) for a certain incompressible flow field it is suggested that the velocity components are given by the equations is this a physically possible flow field? Please help me with this (9/4x+6)-(-5/4x-24) A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 55 C. If an RNA duplex oligonucleotide of identical sequence, substituting U for T, is constructed, how will its melting temperature compare to that of its DNA counterpart? - The tm will be higher. - The effect on tm of replacing U for T cannot be predicted. - The tm will be lower. - The tm will be unchanged. The time it takes a mechanic to change the oil in a car is exponentially distributed with a mean of 5 minutes. (Please show work)a. What is the probability density function for the time it takes to change the oil?b. What is the probability that it will take a mechanic less than 6 minutes to change the oil?c. What is the probability that it will take a mechanic between 3 and 5 minutes to change the oil?d. What is the variance of the time it takes to change the oil? Which of the following statements is the best description of the per capita generation of solid waste between 1960 and 2010?ANSWER:a.Between 1960 and 2010, per capita generation was relatively constant.b.Between 1960 and 2010, per capita generation of solid waste increased steadily.c.Between 1960 and 2000, per capita generation increased.After 2000, per capita generation declined.d.Between 1960 and 1990, per capita generation increased at a steady rate. After 1990, per capita generation continued to increase, but at a slower rate. find the running time equation of this program: def prob6(l): if len(l) Parts of a watershed Reconsider the Fingroup Fund in the previous problem. If during the year the portfolio manager sells all of the holdings of stock D and replaces it with 200,000 shares of stock E at S50 per share and 200,000 shares of stock F at $25 per share, what is the portfolio turnover rate? Well-designed performance evaluation systems accomplish many goals. Consider the following actions and state which goal is being achieved by the action a. Comparing targets to actual resuits b. Providing subunit managers with performance targets c. Comparing actual results with industry standards d. Providing bonuses to subunit managers who achieve performance targets Communicating expectations Motivating segment managers Promoting goal congruence and coordination Providing foedback e. Aligning subunit performance targets with company strategyf. Comparing actual results of competitorsg. Taking corrective actions h. Using the adage "you get what you measure" when designing the performance evaluation system Choose from any drop-down list and then continue to the next question.