[tex]\sqrt \frac{256}{4\\}[/tex]

Answers

Answer 1

Answer:

8

Step-by-step explanation:

[tex]\sqrt{\frac{256}{4} }[/tex]

[tex]\sqrt{\frac{16*16}{2*2} }[/tex]

[tex]\sqrt{(\frac{16}{2})^2 }[/tex]

square and root gets cancel . so ,

[tex]\frac{16}{2}[/tex]

8


Related Questions

please help me solve
please show how you got the answer

Answers

Answer:

Step-by-step explanation:

New questions in Mathematics

In a 30-30-90 triangle, the hypotenuse is 38, what is the length of the shortest side

Pls help this is due at 8 !!!!!!

6. CDs can be manufactured for $0.19 each. The development cost is $210,000. The first 500 discs are samples and will not be sold a. Write function f…

somebody help me out

Which rational functions have an oblique asymptote? Check all that apply

what is the estimate product of 345 and 34? [tex] \\ [/tex] ​

what is the estimate product of 345 and 34?​

ucas y Fernando deciden remontar, cada uno, un barrilete y cuentan con 60m de hilo cada uno. El barrilete de Lucas forma un ángulo de 45º con la hori…

somebody help me out

How many parallelograms are in an octagonal prism?

Tn=2n-5 write down four term in a sequence

somebody help me out !

Find the value of angle n

PLEASE I NEED HELP IM GOING TO CRY I HAVE A TOPIC TEST TOMORROW PLEASE REPLY ASAP.!!!!

Find the value of angle y

What is the midpoint of AB? A G H NT -9-8-7 -6 -5 -4 -3 -2 -1 0 1 2 3 0000 4 5 6 7 8 9 point F O point G O point H pointi

Point A is reflected across line y=x and the n dilated by a factor of 3 using the origin as the center of dilation.

Given that a=3, b=-2 and c= -4, evaluate the following expression. 2c-a/3c+b - 5a+4c/c-a

Please help me asap!​

what is lcm of 15 and 143​

Please Help Quick ASAp Hurry
What is the exact volume of the cylinder?
A. 780π in3
B. 5070π in3
C. 390π in3
D. 11,700π in3

Answers

Answer:

B. 5070π in³

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Geometry

Volume of a Cylinder Formula: V = πr²h

r is radiush is height

Step-by-step explanation:

Step 1: Define

Identify variables

r = 13 in

h = 30 in

Step 2: Find Volume

Substitute in variables [Volume of a Cylinder Formula]:                                V = π(13 in)²(30 in)Evaluate exponents:                                                                                         V = π(169 in²)(30 in)Multiply:                                                                                                             V = 5070π in³

Answer:

[tex]\large\fbox{B. 5070 π inches³}[/tex]

Step-by-step explanation:

We have given that :-Radius of cylinder , r = 13 inchesHeight of cylinder , h = 30 inchesWe need to find :-

The Volume of cylinder

Formula Used :-

Volume of cylinder = π × r ² × h

Where,

r is the radius of cylinderh is the height of cylinderSolution :-

Using Formula

➛Volume of cylinder = π × r ² × h

substitute the values into the formula

➛ Volume of cylinder = π × ( 13 inches)² × 30 inches.

Evaluate exponent

➛ Volume of cylinder = π × 169 inches ² × 30 inches.

multiply, we get

➛ Volume of cylinder = 5070 π inches ³.

Therefore, option B which is 5070 π inches³ is the correct ☑ answer.

What is the mean, outlier & mean without outlier for 4; 4; 5; 6; 8; 9; 27

Answers

Answer:

the mean is 9.

Step-by-step explanation:

mean=4+4+5+6+8+9+27

7

= 63 7 9 is the answer.

A rectangular farm has an area of 1.04 square kilometers. The length of the farm is 0.8 kilometer. What is the width, in kilometers, of the farm.

A) 13.0
B) 10.5
C) 1.3
D) 1.05

Answers

Answer:

[tex]\text{C. }1.3[/tex]

Step-by-step explanation:

The area of a rectangle with width [tex]w[/tex] and length [tex]l[/tex] is given by [tex]A=lw[/tex].

What we're given:

[tex]A[/tex] of 1.04[tex]l[/tex] of 0.8

Substituting given values, we get:

[tex]1.04=0.8w,\\w=\frac{1.04}{0.8}=\boxed{\text{C. }1.3}[/tex]

Write an equation of the line that passes through the point (2, -3) and has a
slope of -1.

Answers

Answer:

Y = -1x - 1

Step-by-step explanation:

I used desmos graphing calculator and tried until I got a line that worked.  It passes through (2, -3) and has a slope of -1

Hope this helped :)

Simplify: 4x(x² - 3x + 1)

Answers

Answer:

[tex]4x\left(x^2-3x+1\right)[/tex]

[tex]Distribute\:parentheses[/tex]

[tex]=4xx^2+4x\left(-3x\right)+4x\cdot \:1[/tex]

[tex]\mathrm{Apply\:minus-plus\:rules}[/tex]

[tex]+\left(-a\right)=-a[/tex][tex]=4x^2x-4\cdot \:3xx+4\cdot \:1\cdot \:x[/tex]

[tex]Simplify[/tex]

[tex]=4x^3-12x^2+4x[/tex]----------------------------hope it helps...have a great day!!

Can someone help me identify what quadrilateral is this?

Answers

Answer:

Its C

Step-by-step explanation:

the graph below have the same shape.
what is the equation of the blue graph?

Help me please ​

Answers

The answer is D.

the blue parabola is 1 y value up from red. So you have a +1. It is 4 values to the right of red, but when x is in the format of (x + a) ^2, then the sign of operation is opposite of the action in graph. So positive means subtracting and negative means adding. So you put in x - 4

Tell whether the angle is complimentary, supplementary or neither

Answers

The answer is supplementary

Find the length of CD

Answers

Answer: CD=18

Explanation: Use the side-splitter theorem and solve.

1) (3/x)=(4.5/(x+6)), cross multiply and solve for x
2) 6x+36=9x
3) x=12
4) Solve for CD
5) (12)+6=18

Una empresa, para comprar ropa de trabajo para su personal, tiene un presupuesto de $ 10.000. La empresa pide cotizaciones y recibe las siguientes propuestas: a) pagar $ 5.000 al contado y $ 5.000 en 90 días; b) pagar $ 3.000 al contado; $ 3.000 en 30 días y $ 4.000 en 90 días; c) pagar $ 2.000 al contado, $ 4.000 en 30 días y $ 4.000 en 84 días. Si la tasa de interés es del 24% anual, ¿cuál oferta le conviene aceptar

Answers

Answer:

La oferta más conveniente es la C, pues en ella se pagará menos dinero que en las dos anteriores.

Step-by-step explanation:

Dado que una empresa, para comprar ropa de trabajo para su personal, tiene un presupuesto de $ 10.000, y la empresa pide cotizaciones y recibe las siguientes propuestas: a) pagar $ 5.000 al contado y $ 5.000 en 90 días; b) pagar $ 3.000 al contado; $ 3.000 en 30 días y $ 4.000 en 90 días; y c) pagar $ 2.000 al contado, $ 4.000 en 30 días y $ 4.000 en 84 días, si la tasa de interés es del 24% anual, para determinar cuál oferta le conviene aceptar se debe realizar el siguiente cálculo:

90 días = 1/4 año

30 días = 1/12 año

84 días = 23/100 año

365 = 1

85 = X

84 / 365 = 0.23

A) 5,000 + (5,000 x 1.06) = 5,000 + 5,300 = 10,300

B) 3,000 + (3,000 x 1.02) + (4,000 x 1.06) = 3,000 + 3,060 + 4,240 = 10,300

C) 2,000 + (4,000 x 1.02) + (4,000 x 1.023) = 2,000 + 4,080 + 4,092 = 10,172

Por lo tanto, la oferta más conveniente es la C, pues en ella se pagará menos dinero que en las dos anteriores.

SUPER URGENT: Find cscθ.

Answers

Answer: -5/4

Step-by-step explanation: Cosecant is hypotenuse divided by the opposite side. The hypotenuse is 5 units, while the opposite side is 4 units. The answer has to be negative because the opposite side is below y=0.

theres $10.30 and the discount is 25% how much will he save

Answers

Answer:

2.58 saved

Step-by-step explanation:

To find the discount, take the amount and multiply the discount percent

10.30 * 25%

10.30 *.25

2.575

Round to the nearest cent

2.58

Answer:

Step-by-step explanation:

2.58 saved

What is the inverse of the function g(x) = 1/2x + 1/2?

Answers

Step-by-step explanation:

Since g(f(x))=x g ( f ( x ) ) = x , f−1(x)=2x f - 1 ( x ) = 2 x is the inverse of f(x)=12x f ( x ) = 1 2 x .

Replace f(x)f(x) with yy.

y=12xy=12x

Interchange the variables.

x=12yx=12y

Solve for yy.

Rewrite the equation as 12y=x12y=x.

12y=x12y=x

Multiply both sides of the equation by 22.

2⋅12⋅y=2⋅x2⋅12⋅y=2⋅x

Simplify 2⋅12⋅y2⋅12⋅y.

Cancel the common factor of 22.

Cancel the common factor.

2⋅12⋅y=2⋅x2⋅12⋅y=2⋅x

Rewrite the expression.

1⋅y=2⋅x1⋅y=2⋅x

Multiply yy by 11.

y=2⋅xy=2⋅x

Solve for yy and replace with f−1(x)f-1(x).

Replace the yy with f−1(x)f-1(x) to show the final answer.

f−1(x)=2xf-1(x)=2x

Set up the composite result function.

g(f(x))

Tony is building a new silo to store corn as animal feed. It will be a cylinder topped with a half-sphere, and must store 21 000 t of corn. The entire silo can be filled with corn. Tony wants to minimize the surface area of the silo to reduce materials and paint costs. He has the following information:
• 1 cubic m of corn has a mass of 700 kg.
• Building costs are $8/m2, taxes included.
• Paint comes in 3.8 L cans.
Each can covers 40 sq m and costs $35,
taxes included.
• Corn costs $140 per tonne ($140/t), taxes
included.

What is the total cost to build, paint, and fill a silo with the least surface area?

Answers

Answer:

all i know is that the answer is

above 2,400

Step-by-step explanation:

Find the equation of the straight line passing through the point (-1,2) which is perpendicular to the line y=x+4

Answers

The answer is y = -x + 3

Question 2
Which of these expressions is equal to 4m + 8m?

Answers

Answer:

12 m

Step-by-step explanation:

Given the expression : 8m + 4m

The numbers 8m and 4m are bound by the addition operator.

When using the addition operator, the Coefficient are are the values added for like terms.

Since both values given can be like terms based on 'm', the Coefficient of m in each vlaue is added ;

Hence, we have ;

8m + 4m = 12m

Write an equation for a circle in standard form with a center at (-6, 5) and has a radius equal to 5. 2 Find the area of the sector if the radius is 8cm show your work below 2 2 Show your work below. You have responded to 0 of 7 questions. Question Details Write an equation for a circle in standard form with a center at (-6, 5) and has a radius equal to 5.

Answers

Answer:

[tex](a)\ (x+6)^2 + (y-5)^2 = 25[/tex]

[tex](b)\ Area = 16.75cm^2[/tex]

Step-by-step explanation:

Solving (a):

Given

[tex](a,b) = (-6,5)[/tex]

[tex]r = 5[/tex]

Required

The equation of the circle

This is calculated as:

[tex](x-a)^2 + (y-b)^2 = r^2[/tex]

So, we have:

[tex](x--6)^2 + (y-5)^2 = 5^2[/tex]

[tex](x+6)^2 + (y-5)^2 = 25[/tex]

Solving (b):

Given

[tex]r = 8cm[/tex]

[tex]\theta = 30^o[/tex] --- Missing from the question

Required

The area of the sector

This is calculated using:

[tex]Area = \frac{\theta}{360} * \pi r^2[/tex]

So, we have:

[tex]Area = \frac{30}{360} * 3.14 * 8^2[/tex]

[tex]Area = \frac{1}{12} * 200.96[/tex]

[tex]Area = 16.75cm^2[/tex]

The pattern 0, 15, 30, 45, ________, follows the "add 15" rule. Use words to describe the rule and write the next term.

pls writ abt 1-2 sentences asap :(((

Answers

Answer: The pattern uses the rule "Add 15", adding 15 per term. Making the next term, 60.

find the volume of a triangular prism ​

Answers

Answer:

96 cu.ft must be the answer to the question..

Answer:

I think 96 cu.ft is the answer

which inequality best represents the graph?

Answers

Answer:

A   y ≥ (1/2)x + 5

Step-by-step explanation:

The shaded area is above the solid line

the correct symbol is

What is the equation of the line

Answers

The answer is

The equation for this line is (0,4)

When -3x + 6 − 3x − 24 + 2y is simplified, the result is

Answers

Answer:

- 6x - 18 + 2y

Step-by-step explanation:

- 3x + 6 - 3x - 24 + 2y

- 6x + 6 - 24 + 2y

- 6x - 18 + 2y

Answer:

-6x -18 + 2y

Step-by-step explanation:

1. Collect like terms:

-3x + -3x = -6x

-24 + 6 = -18

2. Rewrite expression:

-6x -18 +2y

Hope this helps, good luck! :D

Lee y contesta santiago quiere comer la mitad de un pastel y alba quiere un tercio del mismo pastel para repartirlo bien reducen las fracciones a comun denominador ¿en cuantas partes iguales deben dividir el pastel? ¿cuantas partes debe tomar cada uno?

Answers

Answer:

El pastel se debe dividir en 6 partes iguales, de las cuales Santiago debe tomar 3 y Alba debe tomar 2.

Step-by-step explanation:

Dado que Santiago quiere comer la mitad de un pastel y Alba quiere un tercio del mismo pastel, para repartirlo bien se deben reducir las fracciones a su común denominador. Así, para determinar en cuántas partes iguales deben dividir el pastel y cuántas partes debe tomar cada uno se deben realizar los siguientes cálculos:

Santiago = 1/2

Alba = 1/3

2 x 3 = 6

Santiago = 1/2 = 3/6

Alba = 1/3 = 2/6

Por lo tanto, el pastel se debe dividir en 6 partes iguales, de las cuales Santiago debe tomar 3 y Alba debe tomar 2.

solve for x y=7x+5
y = 9x+4

Answers

Answer:

x = 1/2

Step-by-step explanation:

y = 7x+5

y = 9x+4

7x+5 = 9x+4

1=2x

x = 1/2 = 0.5

Answer:

1. [tex]x = - \frac{5}{7} [/tex]

2. [tex] x = - \frac{4}{9} [/tex]

Step-by-step explanation:

[tex]y = 7x + 5 \\ 0 = 7x + 5 \\ - 7x = 5[/tex]

[tex]\boxed{Answer:{\boxed{\green{x = - \frac{5}{7}}}}} [/tex]

[tex]y = 9x + 4 \\ 0 = 9 x + 4 \\ - 9x = 4[/tex]

[tex] \boxed{Answer:{\boxed{\green{x = - \frac{4}{9} }}}}[/tex]

Helpppppppp meeeee please ASAP

Answers

Answer:

(9, 13, 22)

Step-by-step explanation:

We can use the triangle inequality theorem to help us solve this problem. We know that the two shortest sides of a traingle added up (their sum) needs to always be greater than the longest side of the triangle. Taking that information, we can figure out that 9+13=22. 22=22, not 22>22. This means that is the right answer, hopefully that helps!

George has a spinner with three equal sections colored orange, blue, and white. He spins the spinner 100 times. What is the experimental probability of landing on the orange section?

Answers

Answer:

1/3

Step-by-step explanation:

Probability calculates the likelihood of an event occurring. The likelihood of the event occurring lies between 0 and 1. It is zero if the event does not occur and 1 if the event occurs.

For example, the probability that it would rain on Friday is between o and 1. If it rains, a value of one is attached to the event. If it doesn't a value of zero is attached to the event.

Experimental probability is based on the result of an experiment that has been carried out multiples times

probability of landing on the orange section = proportion of the orange section / total proportions of all the colours

= 1/3

Write the following number by entering one digit in each box of the place value chart.

Answers

Answer:

The number itself is 508.231

Step-by-step explanation:

Any multiplying each of the numbers, we will have the specific places

Hundreds

5 * 100 = 500

Tenths

0 * 10 = 0

ones

8 * 1 = 8

Tenths = 2 * 1/10 = 2/10 = 1/5 = 0.2

Hundredths = 3/100 = 0.03

Thousandths = 1/1000 = 0.001

So we simply sum all these to get the number itself as follows

500 + 8 + 0.2 + 0.03 + 0.001 = 508.231

please help! I dont understand how to answer. i got x^2-9x+20=0 as my answer. am i incorrect?

Answers

Answer:

x² - 9x + 20

You are correct.

None of the listed choices are correct.

-----------------------------

I think the question originally had 5 and -4 as the solutions

https://www.jmap.org/Worksheets/A.APR.B.3.ZerosofPolynomialsPR1.pdf

x = {-4, 5}

(x + 4)(x - 5) = 0

x² - 5x + 4x - 20 = 0

x² - x - 20 = 0     Answer E

Step-by-step explanation:

x = {4, 5}

y = (x - 4)(x - 5)

y = x² - 5x - 4x + 20

y = x² - 9x + 20

Name the three similar triangles correspondingly. Start with the original right triangle LMK, then the remaining two right triangles created by the altitude MN.

Answers

Answer:

Step-by-step explanation:

Answer:△LMK △MNK △LNM

im pretty sure thats it

Other Questions
An unstretched ideal spring hangs vertically from a fixed support. A 0.4 kg object is then attached to the lower end of the spring. The object is pulled down to a distance of 0.35 m below the unstretched position and released from rest at time t= 0. A graph of the subsequent vertical position y of the lower end of the spring as a function of t is given above, where y= 0 when the spring was initially unstretched. At which time is the upward velocity of the object the greatest? Out of the people who have already taken their seats at a seminar, 2 people have black hair while 2 people do not. Considering this data, how many of the next 16 people to take their seats should you expect to be black-haired? Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!!