The average temperature for four days was 22°. What must the temperature be on the fifth day in order to make 23° the temperature for the five days?​

Answers

Answer 1

Answer:

27°C

Step-by-step explanation:

Average temperature on 4 days

[tex] = \frac{total \: temperatures \: for \: 4 \: days}{4} [/tex]

Total temperatures for 4 days

= 4(22)

= 88

If the average temperature throughout 5 days is 23°,

total temperature for 5 days

= 5(23)

= 115

Temperature on the 5th day

= total temperatures for 5 days -total temperature for 4 days

= 115 -88

= 27°C


Related Questions

9. Solve 6/7 divided by 36/56 and put answer in simplest form.
A. 2/8
B. 8/6
C.4/3
D. 6/8

Answers

The answer is C. 4/3

Answer: C

Step-by-step explanation:

Fraction division rule: 6 * 56 / 7 * 36

Then divide the numbers: 6 * 8 / 36

Cancel the numbers 6/36 = 1/6

That leaves us with 8/6

Then simplify by dividing by the common factor

8/2 = 4

6/2 = 3

Answer: 4/3

the two rectangular plots of land have properties side lengths what is the perimeter of the smaller rectangle A. 28 B. 32 C. 36 D. 76

Answers

Answer:

I think that it would be b 32

Which of the following would increase if the professional football players were removed from the data set?

Answers

Answer:

the standard deviation of the residuals

Step-by-step explanation:

The removal of the professional football players will cause the correlation, and consequently r2 to become closer to 0 due to the fact that the high school athletes tend to show no association between the number of energy drinks consumed and the number of pull ups that can be done. The slope of the regression line will also be nearly 0 without the professional football players. The standard deviation of the residuals, however, will increase without the presence of the professional football players because the remaining scatter about the new regression line will be greater due to the loss of the 4 professional football players which all had small residuals.

The option that will increase if the football players were removed from the data set is the standard deviation of the residuals

What is standard deviation?

It should be noted that standard deviation simply means the difference between the observed data and the predicted values.

In this case, the standard deviation of the residual will increase if the football players were removed from the data set as the removal of the professional football players will cause the correlation.

Learn more about standard deviation on:

https://brainly.com/question/24298037

Carissa folds 32 TShirts in 8 minutes. How many TShirts can she fold in 20 minutes?

Answers

Answer:

5

Step-by-step explanation:

Answer:

80 TShirts in 20 minutes

Step-by-step explanation:

32/8 = 4 Tshirts in a minute

4 x 20 = 80 TShirts in 20 minutes

k/4 +3=14 What is the answer to this question?

Answers

Answer:

k=44

Step-by-step explanation:

Select the correct answer.
Which of these is a non-real complex number?
OA. 5/17 - 21/4
B.
9 + 375
2
OC. 2 - 0
OD. +
/
Dorot

Answers

Answer:

OD

Step-by-step explanation:

because it gives us error and there's no number

The correct option is (D) .

Which is a non-real complex number?Nonreal complex numbers include pure imaginary numbers and those with a and b values of zero, such as 7 + 2i.A non-real or imaginary number is the name given to the square root of a negative number. For instance, the numbers 1, 28, and 5 are all imaginary numbers.Complex numbers cannot be plotted on the actual number line because they contain imaginary numbers. On the complex number plane, which has a y axis (for the imaginary number) and an x axis (for the real number), they can, however, be measured starting from zero (for the imaginary number).

In all these options , they  are presenting real complex number .Real numbers can be positive or negative, and include the number zero. that is why we select option D .

Learn more about non-real complex number brainly.com/question/20813072

#SPJ2

what is maintenance culture

Answers

Answer:

ways of thinking,behaviour,perciption

Using the photo above, describe what type of symmetry it has.

a. if it has reflection symmetry, draw all lines of symmetry.

b. if it has rotational symmetry, what is all the angle of rotational symmetry (the smallest)

c. if has translational symmetry, what is shape is getting repeated​

Answers

B because it’s rotating in a circle

9514 1404 393

Answer:

  b) rotational symmetry: multiples of 120°

Step-by-step explanation:

The figure does not have a line of symmetry, or a point of symmetry. However, rotating it 1/3 turn (120°) will make it look like itself. Hence, it has rotational symmetry of degree 3. A rotation of any multiple of 120° will map the figure to itself.

Jessica is making a cake. The recipe calls for 2 3/4 cups of flour. She only has a measuring cup that holds 1/4 cup. Explain how she can use the measuring cup that holds 1/4 cup to measure 2 3/4 cups of flour.

Answers

Answer: Jessica can use her measuring cup 11 times.

(hope this helps!)

PLEASE HELP ASAP!!! URGENT

Verify the identity. Sinx/1-cosx = cscx+cotx

Please use the answers shown in the image !! Thank you !!

Answers

Answer:

1) [tex]\frac{\sin x}{1-\cos x} = \csc x + \cot x[/tex]

2) [tex]\frac{\sin x}{1-\cos x} = \frac{1}{\sin x} + \frac{\cos x}{\sin x}[/tex]

3) [tex]\frac{\sin x}{1-\cos x} = \frac{1+\cos x}{\sin x}[/tex]

4) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x \cdot (1+\cos x)}{\sin^{2}x}[/tex]

5) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x\cdot (1+\cos x)}{1-\cos^{2}x}[/tex]

6) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x\cdot (1+\cos x)}{(1+\cos x)\cdot (1-\cos x)}[/tex]

7) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x}{1-\cos x}[/tex]

Step-by-step explanation:

Now we proceed to show all steps needed to demonstrate the trigonometric identity:

1) [tex]\frac{\sin x}{1-\cos x} = \csc x + \cot x[/tex] Given.

2) [tex]\frac{\sin x}{1-\cos x} = \frac{1}{\sin x} + \frac{\cos x}{\sin x}[/tex] Identities for cosecant and cotangent functions.

3) [tex]\frac{\sin x}{1-\cos x} = \frac{1+\cos x}{\sin x}[/tex]             [tex]\frac{a}{b}+\frac{c}{b} = \frac{a+c}{b}[/tex]

4) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x \cdot (1+\cos x)}{\sin^{2}x}[/tex] Existence of additive inverse/Modulative property.

5) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x\cdot (1+\cos x)}{1-\cos^{2}x}[/tex]    Fundamental trigonometric identity.

6) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x\cdot (1+\cos x)}{(1+\cos x)\cdot (1-\cos x)}[/tex]   Factorization.

7) [tex]\frac{\sin x}{1-\cos x} = \frac{\sin x}{1-\cos x}[/tex] Existence of additive inverse/Modulative property/Result.

What is the area of the polygon below?
A. 120 square units
9
10
B. 174 square units
16
C. 66 square units
12
D. 84 square units

Answers

Answer:

D

Step-by-step explanation:

12-9 = 3 square unit

10 x 3 = 30 square unit

9×6 = 54 square unit

54+30 = 84 square units

and thats the answer

The area of the polygon is 84 square units, option D is correct.

What is Area of Rectangle?

The area of Rectangle is length times of width.

The given polygon has two rectangles.

Area of rectangle with length 9 and width is 6 units

Area of rectangle 1 =9×6

=54 square inches

Now Area of rectangle with length 10 and width is 3 units

Area of rectangle 2 =10×3

=30 square inches

Total area = 54+30

=84 square units

Hence, the area of the polygon is 84 square units, option D is correct.

To learn more on Area click:

https://brainly.com/question/20693059

#SPJ5

What is the sum of one sixth and thrice of n​

Answers

Answer:

9

Step-by-step explanation:

6+3 is 9

Answer:

what do you mean by thrice of n?

Step-by-step explanation:

Wouldn't we need to know what n equals?

Two hundred sixty students were surveyed on whether they prefer apple juice or orange juice. A table of relative frequencies is shown. How many more girls prefer apple juice than boys?

Answers

this is a hard question because usually boys prefer apple juice

Answer:

91

Step-by-step explanation:

Arthur earned $22.50 last night delivering lunches for his family's restaurant. He puts 30% of his earnings into his savings account. he then bought a magazine for $3.95 and a CD for $11.49. of the amount earned last night, how much money does arthur have left that is not in his savings account​

Answers

Answer:

$4.26

Step-by-step explanation:

The product of 1 1/2 and 2 is less than, equal to, or greater than 2

Answers

Answer:

The answer is 1 1/2 < 2

Step-by-step explanation:

If we convert 1/2 into a decimal, we would get .5. Add that to 1 and we get 1.5. Therfore, 2 > 1.5

Explain how you would graph the inequality: 3 ≤ x

Answers

Given : Explain how you would graph the inequality: 3 ≤ x .

Solution : Graph in attachment .

Answer:

When you are graphing the equation the line, theline on the graph is going to be vertical. Your line point will be ( 3, 0 ). Then there will be a shaded part of the graph on the right on of the line.

Please help! Find the perimeter of Trapezoid ABCD. (round your answer to the nearest tenth.)

Answer + explanation please!

Answers

Answer:

19.8 units

Step-by-step explanation:

BC = 5

AD = 8

CD = 1²+3²=c²

1+9=c²

√10=c

c=3.1627766

AB = 2²+3²=c²

4+9=c²

√13=c

c=3.6

5+8+3.6+3.16=19.76

Inequality question PLEASE HELP

Answers

Answer:

40x4x<60

x<5

Step-by-step explanation:

40x4x<60

4x<60-40

4x<20

x<20÷4

x<5

pleasee help me i will give you brainliest

Answers

Answer:

40

Step-by-step explanation:

6=110 1=40 because it's not gonna be a higher character

How many digits are in 385,604 ?

Answers

6 llllllllllllllllllll

Answer:

6

Step-by-step explanation:

because 385,604 there is 6 digits

PLEASE HELP !!!! ILL GIVE BRAINLIEST !!!

Answers

Answer:

Hi it's down below! Hope it helps

Step-by-step explanation:

1) The angles are Supplementary

This is because both angles form 180°. The angle below angle "7x+9" is the same as 5x+3.  The angle above angle"5x+3" is the same as 7x+9.

2) They are both supplementary

They form 180°

3)180° = 12x+12°

4) Solving that:

180° - 12° = 12x

168° = 12x

x = 168°/12

x = 14°

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

Answer:

the answer is 14°

Step-by-step explanation:

PLEASE MARK AS BRAINLIEST

Someone please help me answer this!!

Answers

Answer:

b = 9cm is the answer.

Step-by-step explanation:

a = 12cm

b = ?

c = 15cm

By using the Pythagoras theorem,

a² + b² = c²

12² + b² = 15²

144 + b² = 225

b² = 225 - 144

b² = 81

b = 9cm.

∴ b = 9cm is the length of the missing leg.

The area of a poster board is (x2 + 9x – 10) square inches. Find the dimensions of the
poster board if x = 16.
The dimensions of the poster board are
inches by
inches.

Answers

Answer:

                                                 

Step-by-step explanation:

 

Pictures in order !

Answers

Answer:

Step-by-step explanation:

2XV=WY

2(2x+4)=7x-1

4x+8=7x-1

3x=9

x=3

XV=2x+4=10

WY=7x-1=20

increase R700 in the Ratio 3:2​

Answers

Step-by-step explanation:

³93521586335445555554555554488807799654

How do you add
2 2/3 + 6/7

Answers

Answer:

3 11/21

Step-by-step explanation:

2 2/3=(2*3+2)/3=8/3

8/3+6/7=56/21+18/21=74/21 or 3 11/21

The population of a city decreases by 2.5% per year. If this year's population is 237,000, what will next year's population be, to the nearest individual?

Answers

231075 All you got to do is 237,000 - 2.5%

Help please is for now

Answers

Answer:

In linear functions, rate of change is constant: as x goes up, y will go up a consistent amount. In exponential functions, the rate of change increases by a consistent multiplier

Step-by-step explanation:

Answer:

Linear functions change at a constant rate per unit interval. An exponential function changes by a common ratio over equal intervals.Step-by-step explanation:

ASAP PLEASE HELP!!! Given the cylinder with the given dimensions, match the measures of the radius, circumference, and area of the base.

Answers

Answer:

Radius of cylinder = 4.5 inch

Circumference of Base = 9π inch

Area of base = 20.25π

Step-by-step explanation:

Given:

Diameter of cylinder = 9 inch

Height of cylinder = 22 inch

Find:

Radius of cylinder

Circumference of Base

Area of base

Computation:

Radius of cylinder = Diameter of cylinder / 2

Radius of cylinder = 9 / 2

Radius of cylinder = 4.5 inch

Circumference of Base = 2πr

Circumference of Base = 2π(4.5)

Circumference of Base = 9π inch

Area of base = πr²

Area of base = π(4.5)²

Area of base = 20.25π

Calculate the finance charge for a credit card that has an average daily balance of Php5,600 and a monthly interest rate of 1.35 %

Answers

Answer:The simplest way to calculate a finance charge is: balance X monthly rate

Step-by-step explanation:

i thinkk

500 X .015 = $7.50

The finance charge for a credit card that has an average daily balance of 5,600 and a monthly interest rate of 1.35 % is $75.6.

What is the finance charge?

The finance charge is the product of an average daily balance to the monthly interest rate.

finance charge = balance x monthly rate

The simplest way to calculate a finance charge = balance x monthly rate

= 5,600 x 0.0135

= $75.6

Thus, the finance charge for a credit card that has an average daily balance of 5,600 and a monthly interest rate of 1.35 % is $75.6.

Learn more about finance;

https://brainly.com/question/22786445

Other Questions
In 12 sentences, describe the relationship between heat and thermal insulators.(2 points)A baker uses oven mitts to open an oven, take a loaf of bread out, and place it on a plate. In 34 sentences, identify three examples of thermal energy transfer in the scenario.(4 points) why is yhe greatest amoug of eergy soted in a molecyle of atp The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future?