The division of the cytoplasm, which follows Mitosis, is called...

Answers

Answer 1

Answer:

Cytokinesis,

Explanation:

Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.

Answer 2

The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.

What is Mitosis?

Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.

In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.

Read more about Cell

https://brainly.com/question/2622341

#SPJ2


Related Questions

5. Why might a cell need to phagocytose?

Answers

Answer:

Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.

Explanation:

The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?

A.
the liquid will become a solid

B.
the temperature of the liquid will increase

C.
the temperature of the liquid will decrease

D.
the molecules will gain mass

Answers

Answer:

I believe the answer to this question is B

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.

True or False: Epinephrine enters
the cell after it binds to the receptor.

Answers

i believe it’s true ...

Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.

What are the functions of epinephrine?

Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.

Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.

Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.

Learn more about epinephrine:

https://brainly.com/question/3882731

#SPJ2

What abiotic factors might affect a population of fish? Check ALL that apply.

clear water
light
temperature
food

Answers

Answer:

Clear water, light, and tempature.

Explanation:

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking

The electrons that travel through electron transport chain #1 (and that have been excited off of the chlorophyll molecules on photosystem #2) are used to

Answers

Answer:

energy released in these electron transfers is used to form an electrochemical gradient. In chemiosmosis, the energy stored in the gradient is used to make ATP.

Explanation:

Hope this helps :)

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these​

Answers

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

Which natural resource is nonrenewable?

sunlight


sugarcane


oil or petroleum


corn​

Answers

Answer:

There are four major types of nonrenewable resources: oil, natural gas, coal, and nuclear energy. Oil, natural gas, and coal are collectively called fossil fuels.

The natural resource is nonrenewable oil or petroleum is a carbon primarily based totally gasoline .

What are nonrenewable resources?

There are 4 essential varieties of nonrenewable resources: oil, herbal gas, coal, and nuclear energy.

Oil is a carbon primarily based totally gasoline that bureaucracy while plant and animal stays are uncovered to intense situations which include excessive pressure (eg below a dust layer on the sea floor.) for hundreds of years. Therefore the oil we use these days took millennia to form.

Read more about oil here:

https://brainly.com/question/25614315

#SPJ2

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

Which belongs in each place

Answers

Answer:

1=e, 2=b, 3=c, 4=d, 5=a

Explanation:

.

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

Why do the cells used for reproduction only have half (½) of the DNA that other cells have?

Answers

Answer:

Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.

Explanation:

Anaerobes carry on whereas aerobes carry on cellular respiration

Answers

Answer:

Anaerobes carry on cellular respiration in the absence of oxygen, whereas aerobes carry on cellular respiration in the presence of oxygen.        

Explanation:

Many of the cell processes needed need some energy to occur. Cellular respiration is the process by which cells degrade organic compounds and turn them into energy. Cellular respiration follows two ways, which depend on the presence or absence of oxygen, and both of them begin with the process of glycolysis, which occurs in the cytoplasm and does not need oxygen to occur.

Aerobic Respiration

Occurs in the presence of free oxygen.Series of reactions by which pyruvic acid (product of glycolysis) turns into CO₂ and H₂O, producing many ATP molecules. Respiration occurs in the mitochondria.Takes place in two steps or stages: Krebs cycle and electron transporter chain. Glycolysis and Krebs cycle produce electrons, which then travel along the electron transporter chain while releasing energy, and ATP is produced.

Anaerobic Respiration

Occurs in the absence of free oxygenSeries of reactions by which using pyruvate (product of glycolysis) 2 ATP molecules van be produced. There are two ways in which anaerobic respiration can be produced: lactic fermentation and alcoholic fermentation. Lactic fermentation produces lactic acid and 2 ATPAlcoholic fermentation occurs in two steps, and the final products are ethylic alcohol, 2ATP, and 2 CO₂The whole anaerobic process occurs outside the mitochondria.

Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Answers

Answer:

A. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.  - 3.dangerous.

B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.

C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say. - 2.conciliatory.

D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .

Explanation:

The given underlined words in each sentence are-

1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.

2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.

3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.

4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.

Answer:

- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.

- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.

- 2.conciliatory.

He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say.

- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Explanation:

If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.

Answers

Answer: C.

has different alleles on the chromosomes in a chromosome pair

Explanation:

Hetero means different.

A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.

What is the particular trait for heterozygous organism?

When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.

Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.

The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.

Therefore, has different alleles on the chromosomes in a chromosome pair.

Learn more about heterozygous here:

https://brainly.com/question/29327683

#SPJ2

True or false the main source of energy and water cycle is gravity

Answers

Answer:

False please mark me brainlest.

Explanation:

What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

Answers

Answer:

B.

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes

Answers

The answer would be A.thunderstorms

Hope this helps

Have a great day/night

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

Identify the advantages and disadvantages of internal and external fertilization

Answers

When a sperm fertilizes an egg within the female, it is known as internal fertilization. The advantages of internal fertilization are that the fertilized egg is protected from predators and harsh environments, thus ending in higher chances of survival. Also, there is a lesser chance of desiccation of gametes. Disadvantages of internal fertilization are that there are lesser number of offspring produced at a given time because it is sometimes difficult for the male and female to come into intimate contact. Additionally, the risk of sexually transmitted diseases also increases.

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Write a sentence about tissues. (ITS FOR SCIENCE SO PLS)

Answers

Answer: There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue. Connective tissue supports other tissues and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of the various passages inside the body)

Please help I'm behind

Answers

Answer:

B : Barometer

Explanation:

A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.

Other Questions
A paper company needs to ship paper to a large printing business. The paper will be shipped in small boxes and large boxes. Each small box of paper weighs 35 pounds and each large box of paper weighs 70 pounds. A total of 22 boxes of paper were shipped weighing 1260 pounds altogether. Graphically solve a system of equations in order to determine the number of small boxes shipped, x, and the number of large boxes shipped, y. Find the whole number equal to the fraction shown,6\3A.) 6B.) 2C.) 1D.) 3 Sunflower we haved renewed your helper thank you with working with our business What are two tools that can be used to measure wind direction? The list shows numbers in order from least to greatest? Both of the stories are adventure stories about finding treasure. Which of the following describes a similarity between the two stories in regard to the nature of the treasure hunts? In both stories, the characters have some clues and riddles to solve, and they solve them with the help of the characters they are working together with on the treasure hunt. In both stories, the characters set out on an adventurous treasure hunt where they are searching for ancient, long-lost treasure. In both stories, the characters set out on a treasure hunt because a friend or family member has set up the hunt as a fun activity, and they are promised a reward In both stories, there is a certain element of danger that the characters encounter, and they overcome the dangerous obstacles with the help of the other characters. Conjugate these verbs in all their forms:almorzar:volver:dormir:comenzar:preferir:mentir:pedir:repetir:traer:poner:decir:salir:will give brainliest :) Given the following probability distribution, find the mean.P(x)XP(x)2.234415.129.24EP) =xP(x) = 1Mean = Find the volume of a cone with a height of9in and a diameter of 12in. 3 Write an expressionto represent:"Twice a number 51increased by 51" PLZ HELPTriangle ABC is similar totriangle FGH. What is thevalue of x in centimeters? cost to store 155 mark up 30 Read the passage.EarthshipsWhat is an earthship?An earthship is a home designed to make use of recycled materials and increase energy conservation. Ideally, by living in an earthship, a person can have a home that is off the grid. People who live in earthships do not depend on outside sources for electricity, food, or water. Building an earthship may be an attractive choice for those who want to use fewer of our planets non-renewable resources.The FoundationFirst, the foundation is built by firmly packing dirt inside recycled tires. Then, the tires are placed in a pyramid-like stack going as high as needed. Next, cement is spread and smoothed between the tires to create a solid wall. When this is finished, the walls are sealed with a protective coating and painted. Some interior walls are built using recycled cans and cement, also sealed with a protective coating.Solar EnergySolar panels give enough stored energy in batteries to provide electricity for appliances, lighting, and electronics. However, solar-powered batteries hold about one-third the charge of energy used in a regular household wired for electricity. This means that people either buy more batteries or intend to use less electricity than a conventional household. Ideally, earthships are built in places where there is an abundance of sunshine year-round.Floor-to-ceiling windows on an earthships south wall also allow plenty of sunlight. It is important that no trees block the light on this side of the house. The sunlight shines directly onto a brick floor, which then absorbs the heat. This provides enough warmth to maintain a comfortable temperature in the house for the rest of the day. This method of heating the home is called passive solar. Most earthships also have either a wood stove or a heater that uses propane, a type of natural gas. These heat sources are useful on cloudy days. During the summer, the combination of the cool temperature of the earth beneath the floor plus the thick walls can keep the house comfortable without the use of air-conditioning.Recycled WaterGutters on the roof collect rainwater that then trickles down into large storage barrels. The water is used for taking showers, doing dishes, and flushing the toilet. It is also filtered for drinking. People sometimes build a greenhouse to grow their own food. Water that has been used for dishwashing or showers can be saved if the soaps are chemical-free. This recycled gray water can be used yet again to water the plants in the greenhouse.Potential ProblemsEarthships have been around since the 1970s. Now, long-term studies have revealed some problems. For one, without sufficient sunlight during the winter, large amounts of natural gas known as propane and/or wood are used to heat the home. Propane use can be costly, and unless one has planned far ahead, a wood supply can be quickly depleted.Another problem is that tires used in the foundation walls can, after a long period of time, begin to crack, releasing a toxic gas that has built up over time in the walls. The use of cement, which is a porous material with many small holes and spaces, allows the gases to leak into the air. The type of gas emitted is not detectable by smell but can make people sick. To address this problem, the walls of the home needs to be resealed every year.Cost can also be a significant challenge. Some earthship building companies claim that it is far cheaper to build an earthship because only recycled materials are used. Also, a contractors license or training is not needed to build one. This, though, is true if it is built 100% by the owner, which could take years to complete. Additionally, the cement, plumbing, and electrical components, as well as the cost of installing solar panels, can be expensive. Just as with the construction of a conventional home, proper permits are often needed to build an earthship.There are clear advantages and disadvantages to these unique homes. As technology improves and new solutions are discovered, earthships may continue to be a wise way to live sustainably using minimal resources.What inference can be made about how building earthships impacts the environment?Question 5 options:It is beneficial because it removes unnecessary trees.It is harmful because it uses old tires.It is wasteful because solar panels are expensive.It helps by using mostly recycled material instead of natural resources. 1.9t-5 simplify using commutative property Pls help lolll Why does the Easter bunny carry eggs? Rabbits don't lay eggs. People may exercise their right to vote in Washington unless theyO live permanently in another state.O refuse to pay a poll tax.O are unable to work.O were born in another country. Find the slope and the y-intercept of the graph of y - 2= 3/4 x PLZ HELP!!! What is the purpose of most of the Ulster Scots music? Please help with my English, I'll mark brainliest Which one of these is NOT one of the characteristics of living things? A.All living things reproduce.B.All living things are composed of one or more cells.C.All living things grow develop and have life spans.D.All living things provides heat and light on Earth.