The energy in the bonds in glucose gets transferred to ATP.
What is Cellular respiration?Cellular respiration may be defined as the process by which organisms incorporate oxygen with foodstuff molecules, pivoting the chemical energy in these substances as waste products, carbon dioxide, and water.
The complete question is as follows:
The energy is transferred to oxygen. The energy is transferred to carbon dioxide. The energy is transferred to the water. The energy is transferred to ATP.Cellular respiration involves the transformation of energy from glucose to the formation of ATP via ADP. ATP operates as the major energy molecule and is required by nearly every cell to carry out its normal functions.
Therefore, the correct option for this question is D, ie. The energy is transferred to ATP.
To learn more about Cellular respiration, refer to the link:
https://brainly.com/question/2809259
#SPJ1
What factors can limit growth?
competition
amount of sunlight or water
r-selected species
geographic borders
The answer is
Amount of sunlight or water.
As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.
learn more things about what factors growth
https://brainly.com/question/3944507
PLEASE HELP PLEASE
Do you think this is a good way to eliminate invasive species from an ecosystem? Do you think the risks of the gene drive getting into another species are worth gaining biodiversity in an ecosystem? Explain your opinion.
Use of bioagent is a good way to eliminate invasive species from an ecosystem.
What is a good way to eliminate invasive species from an ecosystem?In my opinion, to eliminate the invasive species from an ecosystem we should find out its bioagent instead of chemical spraying because bioagent does not adversely affected the environment.
The risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem because it leads to many consequences and unpredictable effects on ecosystem.
So we can conclude that use of bioagent is a good way to eliminate invasive species from an ecosystem.
Learn more about invasive here: https://brainly.com/question/1542287
#SPJ1
Yes, it is a good way to eliminate invasive species from an ecosystem. This is because invasive species play a critical role in the limitation of biodiversity of a particular ecosystem.
What is Biodiversity?Biodiversity may be defined as the sum total of all the variety of living organisms in a particular ecosystem.
No, the risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem. This is because it directs considerable influences and unanticipated impacts on the ecosystem.
Therefore, it is well described above.
To learn more about the Ecosystem, refer to the link:
https://brainly.com/question/26551655
#SPJ1
Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation
I'll give brainly to whoever response is good !
please help me :C
Answer:
At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.
Which of the following is a natural resource for humans?
A-Cars
B-Electricity
C-Houses
D-Wood
Which feature of the ocean floor includes its deepest parts?
3. Meiosis is a process that occurs during cell division that leads to the production of gametes It halves the number of chromosomes that can be passed on to an offspring. It also produces new combinations (variations) of an organism's genetic material Use evidence you obtained from modeling meiosis to show that both statements are true
Answer:
reproduction
Explanation:
different traits
What process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates?
Answer:
Precipitation
Explanation:
Precipitation refers to a process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates.
Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?
This is the complete question.
Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor
in their work that could increase their chances of cancer?
A. Scientists who work with toxic chemicals
B.therapist who operate radiation machine
C.nurses who treat patients with viral infections
D.researches who study DNA replication
Research that study DNA replication. Thus, option "D" is correct.
What is cancer?Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.
Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.
Thus, option "D" is correct.
To learn more about Cancer click here:
https://brainly.com/question/8590464
#SPJ1
Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.
Answer:
B.) Can lead to new species that share common ancestors
Explanation:
Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).
Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?
The correct options would be B and E.
Variation in population sizeThe population size of each organism in different zones may not vary much due to the following:
Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.More on adaptations of organisms can be found here: https://brainly.com/question/1686177
#SPJ1
An organism that is eaten by a predator is
Prey is a term given to the organism that is eaten by the predators.
4. Which statement best describes how scientists formed cell theory?
A:Pasteur observed that cork was made of cells and published his findings
widely,
B:Multiple scientists and observations contributed to the formation of cell
theory.
C:Schwann observed that plants are made of cells and shared his theory at
conferences.
D:Remak wrote cell theory after realizing that cells cannot come from non-
living matter.
Answer:
A is the answer
Explanation:
please mark me as brainlist
how can global warming lead to changes to the Earth's surface?
Answer:
It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.
what would most likely happen if a person increased the amount of saturated fat in his or hers diet?
If a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well.
What is the harmful effect of saturated fatty acids?Because saturated fatty acids are completely saturated with hydrogen, they require more energy to break down and generally remain in the solid at room temperature, as well as inside the body, where they can induce heart-related diseases and obesity by blocking blood vessels. For example, butter contains saturated fatty acids, which are generally not recommended in large quantities.
Hence, if a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well..
Learn more about the harmful effects of saturated fatty acids here.
https://brainly.com/question/14118324
#SPJ2
We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous
Answer:
We can mold metals into different shapes because they are _malleable__.
Explanation:
Malleable (ability to be hammered into thin sheets)
Who establishes a crime scene?
options:
crime scene photographer
criminal investigator
first responder
district attorney
Answer:
first responders
Explanation:
no need for explaining
Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?
A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers
Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.
How, explain your answer briefly?The construction of dams in rivers has blocked the path of some salmons returning to spawning grounds.
The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.
Thus, option "D" is correct.
To learn more about salmons click here:
https://brainly.com/question/16208604
#SPJ1
Describe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease
Answer:
escribe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease
Explanation:
The backbone is also known as the vertebral column. Justify in accordance with both the
terms used
You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.
A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.
What are salinity and conductivity measurements?Salinity is a measure of the salt content of a water body.
Conductivity is a measure of the electrical conductivity of a solution or substance.
Conductivity increases with increase in salinity.
An estuary is a region where salt water from the sea meet freshwater from a river or stream.
At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.
Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.
Learn more about salinity and conductivity at: https://brainly.com/question/2472580
#SPJ1
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA
In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
What are restriction enzymes?Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).
These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.
In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
Learn more about restriction enzymes here:
https://brainly.com/question/15278286
#SPJ1
For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?
Answer:
Some bacteria have mutated and are not killed by the penicillin
Explanation:
What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional
. Which describes the function of the cell cycle in such single-celled organisms?
reproduction
repair
growth
protection
One possible reason for the rise in the average air temperature at the Earth's surface is that
Answer:
cimate change
How might compound leaves and leaves with lobed margins be well-suited to windy environments?
Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.
What is a plant adaptation?A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.
Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.
In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.
Learn more about plant adaptations here:
https://brainly.com/question/29594
#SPJ1
Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent
the correct answer is detergent which is not approved
The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.
What is a hand sanitizer?Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.
Detergents are not approved during the formation of hand sanitizer.
Thus, the correct option for the given scenario is D.
For more details regarding sanitization, visit:
https://brainly.com/question/4296165
#SPJ2
Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?
The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.
What is Taxonomic classification system?This is defined as the classification of organisms based on shared characteristics.
This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.
The complete question is:
Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.
Which of the following best explains why a standardized classification system is important to the scientific community?
Read more about Taxonomic classification system here https://brainly.com/question/11724129
#SPJ1
The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which
10 points!
A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.
Answer:
it’s a spore
Explanation:
it should be a spore. It’s because the spore is the haploid.