The figure is cut into 6 equal pieces. shade 2/3 of the figure

Answers

Answer 1

Answer:

you need to shade 4/6

Step-by-step explanation:


Related Questions

The length of a rectangle is three times the width. The perimeter of the rectangle is 72 cm. Find the dimensions of the rectangle.

Answers

Answer: length=27, width 9

Step-by-step explanation: To solve this problem, you should set up an equation. The length is 3x, and the width is x. To find the perimeter of a triangle, you do length times two + width times two. So 6x+2x=72. 8x=72, x=9. Length is 27, width is 9.

Answer:

Length: 27cm

Width: 9cm

Step-by-step explanation:

Since the length of the rectangle is 3 times the width, we can assume the    width=x and the length=3x.

      P=72cm

     Perimeter= 3x+3x+x+x

Set the 2 equations equal to each other

   72=3x+3x+x+x

Solve for x

   72=8x

   9=x

Length=3x

   Length=9(3)

   Length=27

Width=x

   Width=9

   

Solve 2 + 1/6x = -4.
X=

Answers

First, isolate x. Subract 2 from both sides.
1/6x = -6.
Then, to get rid of the coefficient on x, multiply both sides by 6.
x = 36

Nancy found that x=1 is one solution to the quadratic equation (x+2)2=a. What is the value of a? -9 -3 3 9

Answers

Answer:

9

Step-by-step explanation:

because thats the answer i just did the quiz

have a good day

The solution to the quadratic equation (x+2)2=a if one of the solution is 1 is 9

How to find the solution to a quadratic equation?

Given the quadratic equation

(x+2)^2=a

If one of the solution is 1, then x = 1

substitute

(1 + 2)^2 = a

3^2 = a

a = 9

Hence the solution to the quadratic equation (x+2)2=a if one of the solution is 1 is 9

Learn more on quadratic equation here:https://brainly.com/question/1214333

Given the following system, the x-value of the solution is -1. Solve for y.

Answers

Answer
Y= 3
Y=3
Explanation
If you need to show work I can put it in the comments:)

Answer:

1. y=3

2. y=3

Step-by-step explanation:

Let's start with the first one, 2x-2y=-8...

Substitute x with -1 -----> 2(-1)-2y=-82 times -1 makes -2 so new equation is ---> -2-2y=-8Now add 2 on each side to get rid of 2 and get this ----> -2y=-6Now divide -6 by -2 to get this ---->  y=3

Let's start with the second one, 2x+2y=4

Substitute x with -1 -----> 2(-1)+2y=42 times -1 makes -2 so new equation is ---> -2+2y=4Now add 2 on each side to get rid of 2 and get this ----> 2y=6Now divide 6 by 2 to get this ---->  y=3

I hope my explanation and answer helps:)

PLZ HELP :)
The graph of linear functions f(x) and g(x) are shown on the graph. Which function is best represented by the graph of g(x)?
A. g(x) = 3f(x)
B. g(x) = f(x)+3
C. g(x) = f(x-3)
D. g(x) = f(x+3)

Answers

The answer is A I think

What is the value of any number raised to the 0 power?

Answers

Always be 1, stated in the Zero Power property

The owner of a pet store sells 5 goldfish for $9 . What is the cost in dollars for one goldfish

Answers

Answer:

The answer is C.

Step-by-step explanation:

Took the lesson on edge 2021

Find the value of x.

Answers

Answer:

x = 29

Step-by-step explanation:

The two labeled angles are same-side interior angles of parallel lines cut by a transversal. They are supplementary, so their measures have a sum of 180 deg.

2x - 10 + 4x + 16 = 180

6x + 6 = 180

6x = 174

x = 29

brainlest for whoever gets it right

3/4 - 1 and 1/2

Answers

Answer:

-0.75

Step-by-step explanation:

Answer: the answer would be -0.75, or -3/4

If x = 14, which equation is true?
A.3 ( 20 − x ) = 44
B.3 ( 12 − x ) = 6
C.2 ( x − 3 ) = 22
D.2 x − 3 = 22

Answers

Answer:

C.  2 ( x − 3 ) = 22

Step-by-step explanation:

if x = 14

2 ( x − 3 ) = 22

2 (14 - 3) = 22

2 (11) = 22

22 = 22

therefore, the answer is C.

A movie theater had tickets at $12 for adults, $7 for students and $5 for children under 12 years old. A total of 278 tickets were sold for one showing with a total revenue of $2600. If the number of adult tickets sold was 10 more than the combined total of student and children tickets, find a system that could model this situation

Answers

Answer:

Step-by-step explanation:

Multiply the members of the revenue equation by 2:

system%28a%2Bs%2Bc=278%2C12a%2B7s%2B5c=2600%2Ca=2s-10%29

Three linear equations in three unknowns. Solve.

In one year, Linda's parents spend $2400 on cable and internet service. If they spend the same amount each month, what is the resulting monthly change in the family's income? *

Answers

Answer: $200

Step-by-step explanation:

Given: In 1 year ,

Linda's parents spend $2400 on cable and internet service.

If they spend the same amount each month, Monthly payment = [tex]\dfrac{\text{Total money spent in 1 year}}{\text{Number of months in a year}}[/tex]

[tex]=\dfrac{\$2400}{12}\ \ \ [\text{Number of months in a year}=12]\\\\=\$200[/tex]

Hence, the resulting monthly change in the family's income = $200

Find the area of the triangle.

Answers

Answer:

A

Step-by-step explanation:

Please help I really need it I am in a timed test I will choose brainliest!

Write the standard form of the equation of a line with a slope of -4 passing through the point (1, -4).

Select one:
a. -4x - y = 0
b. -x - 4y - 15 = 0
c. x + 4y + 15 = 0
d. 4x + y = 0

Answers

I think the answer is a.

Answer:

Step 1: We must determine the equation of the line in slope-intercept form* by solving for b.

[tex]-4 = -4(1) + b\\\\-4 = -4 + b\\\\0 = b[/tex]

Step 2: Now we write the equation in slope-intercept form.

[tex]y = -4x[/tex]

Step 3: We can now change the above equation to standard form by moving variables to one side.

[tex]y = -4x\\\\4x + y = 0[/tex]

Our answer is D. 4x + y = 0.

*Slope-intercept form: y = mx + b.

what is an y-intercept

Answers

Answer:

the point where the line on the graph meets the y-axis

Answer:

What is an y-intercept ?

A y-intercept is in analytic geometry, using the common convention that the horizontal axis represents a variable x and the vertical axis represents a variable y, a y-intercept or vertical intercept is a point where the graph of a function or relation intersects the y-axis of the coordinate system. As such, these points satisfy x= 0.

Step-by-step explanation:

Roman civilization began in 509 BC and ended in 476 A.D Roman civilization last show working​

Answers

Answer:

Roman civilization lasted for 985 years.

Step-by-step explanation:

Given that Roman civilization began in 509 BC and ended in 476 A.

All we have to do is to subtract -579 from 476.

i.e.

[tex]476 - (-509)[/tex]

[tex]=476+509[/tex]

[tex]=985[/tex] years

Thus, Roman civilization lasted for 985 years.

Find the slope of each line in the figure.
Slope of p =

Slope of q =

Slope of r =

Slope of m =

Slope of n =

Answers

Answer:

slope of p= -7/12

slope of q= -3/6.8

slope of r= -16/6.4

slope of m= 6.2/15.5

slope of n= 6.8/17

Step-by-step explanation:

The slopes of the line are given as 2.5 for p and q and -2.5 for r, m and n respectively.

What is the slope of straight line?

The slope of a straight line is the tangent of the angle formed by it with the positive x axis as the reference.

The negative slope indicates the rate of decrease while the positive shows the rate of increase.

The slope of the given lines can be obtained as follows,

(a) In order to find slope of line p,

Use the formula m = (x₂ - x₁)/(y₂ - y₁) and substitute the corresponding values to get,

m = (-3 - 8)/(0.4 - (-4))

⇒ m = -2.5

(b)  In order to find slope of line q,

Use the formula m = (x₂ - x₁)/(y₂ - y₁) and substitute the corresponding values to get,

m = (13 - 0)/(6.8 - 12)

⇒ m = -2.5

(c)  In order to find slope of line r,

Use the formula m = (x₂ - x₁)/(y₂ - y₁) and substitute the corresponding values to get,

m = (13 - (-3))/(6.8 - 0.4)

⇒ m = 2.5

(d) In order to find slope of line m,

Use the formula m = (x₂ - x₁)/(y₂ - y₁) and substitute the corresponding values to get,

m = (-15.5 - 0)/(0 - 6.2)

⇒ m = 2.5

(e)  In order to find slope of line n,

Use the formula m = (x₂ - x₁)/(y₂ - y₁) and substitute the corresponding values to get,

m = (-5 - 12)/(- 6.8 - 0)

⇒ m = 2.5

Hence, the slopes of first two lines are 2.5 and of the remaining three are 2.5.

To know more about slope click on,

https://brainly.com/question/3605446

#SPJ2

Consider the equation 1.5x+4.5y=18. For each question, explain or show your reasoning.




Where does the graph intersect the y-axis (answer should be an ordered pair)?

Answers

Given:

The equation is

[tex]1.5x+4.5y=18[/tex]

To find:

The y-intercept (in ordered pair).

Solution:

We have,

[tex]1.5x+4.5y=18[/tex]

Putting x=0, we get

[tex]1.5(0)+4.5y=18[/tex]

[tex]0+4.5y=18[/tex]

[tex]4.5y=18[/tex]

Divide both sides by 4.5.

[tex]y=\dfrac{18}{4.5}[/tex]

[tex]y=4[/tex]

So, y-intercept is 4.

Therefore, the graph intersect the y-axis at (0,4).

(SHOW YOUR WORK) 67.5+23.57

Answers

67.5 + 23.57=
91.07

[tex] \: \: 67.5 \\ + \underline{23.57} \\ \: \: \: \: \green{\boxed{ 91.07}}[/tex]

Can someone plz explain I would appreciate it

Answers

Answer:

Angle of depression

Step-by-step explanation:

19. Find 3 consecutive integers such that twice
the least integer is 12 more than the greatest
integer.

Answers

Answer:

et's start by defining the three consecutive integers.

.

If x represents the least of the three, then the next consecutive integer is x+1 and the

next consecutive integer is 1 more than that ... or x + 2

.

So the three consecutive integers are x, x+1, and x+2.

.

Twice the least integer is, as you correctly wrote, 2x.

.

12 more than the greatest integer is x+2 + 12 = x + 14

.

Since these two amounts must be equal, you can write:

.

2x = x + 14

.

Now you need to get rid of the x on the right side so that you end up with all the terms

containing x on one side of the equation and everything else on the other side. You can

get rid of the x on the right side by subtracting x from the right side. But if you subtract

 

something from the right side, you must also subtract it from the left side to keep the

equation in balance. So subtract x from both sides. When you do that, the x disappears

from the right side and the left side becomes 2x minus x which is just x.

.

So the equation is reduced to:

.

x = 14

.

If x is 14 then the next two consecutive integers are 15 and 16 ... x+1 and x+2. So the

three consecutive integers are 14, 15, and 16.

.

Check ... the least integer is 14. Twice the least integer is 28. Is 28 actually 12 more

than the greatest integer which is 16? Yes it is, so the problem checks.

.

You were on the right track, but you just needed to know the difference in the three integers

was that they were x, x+1, and x+2. Hope this helps to show you how you could work the

problem through to get the final answer.

Step-by-step explanation:

find the inverse ratio of 12:13

Answers

Answer:

13/12

Step-by-step explanation:

The high temperature on monday was -14 degrees. On Tuesday the high temperature was 24 degrees. Which integer represents the difference in high temperature on these 2 days?

Answers

The difference between the high temperatures on Monday & Tuesday is 38.

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

The integer that represents the difference in high temperature from Monday to Tuesday is 38.

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

The high temperature on Monday was -14 degrees.

On Tuesday the high temperature was 24 degrees.

The temperature difference between Monday and Tuesday.

= Temperature on Tuesday - Temperature on Monday

= 24 - (-14)

= 24 + 14

= 38

Thus,

The integer that represents the difference in high temperature from Monday to Tuesday is 38.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

Find the LCM of 3, 5, and 20.
Plz help

Answers

Answer:

60

Step-by-step explanation:

3×20 is 60, and it works with 5, and it is the smallest possible Multiple

Answer:

60

Step-by-step explanation:

Find the prime factorization of each number:

3 = 3

5 = 5

20 = 2^2 * 5

LCM = product of common factors with greatest exponent and non-common factors.

LCM = 3 * 5 * 2^2 = 15 * 4 = 60

I need help please lol

Answers

Answer:

Omg I have a test too and it's due at midnight :/

Step-by-step explanation:

Omg i bave a test too it’s tonight

The formula for the volume of a cylinder is V = arh.
Solve v = 12h for h, the height of the cylinder.


Answers

Answer:

A

Step-by-step explanation:

You would divide it by pie r squared to get h then flip the equation around so it would be

h= v/ pie r squared

Answer:

A) H= V/ π r^2

Explanation

V = π r^2 H

V = π × r × r × H

V/ π r^2 = H

H = V/π r^2

I’m offering 29 points!!!!!!!! AQRS = ATUV Name the angle or side that corresponds to the given part for the question.

Answers

A, C and D because the angles are named in order. Q=T R=U and so on

How do you name the median of this triangle?​

Answers

Answer:

F

Step-by-step explanation:

The median is always the letter in the middle


The point 3/4 of the way from A(-4,- 7) to B(12, 5)

Answers

Answer:

The coordinates of C are (8,2)

Step-by-step explanation:

We are given the segment from A(-4,-7) to B(12,5) and it's required to find a point C(x,y) that is located at 3/4 of the distance from A to B.

This means that:

[tex]d_{AC}=3/4\cdot d_{AB}[/tex]

where dAC is the distance from A to C and dAB is the distance from A to B.

The same proportion of the distances is satisfied by the coordinates of the point C, that is:

[tex]\displaystyle x-x_A=\frac{3}{4}(x_B-x_A)[/tex]

Adding xA:

[tex]\displaystyle x=\frac{3}{4}(x_B-x_A)+x_A[/tex]

[tex]\displaystyle x=\frac{3x_B+x_A}{4}[/tex]

Similarily:

[tex]\displaystyle y=\frac{3y_B+y_A}{4}[/tex]

Calculating:

[tex]\displaystyle x=\frac{3(12)-4}{4}[/tex]

x = 8

[tex]\displaystyle y=\frac{3(5)-7}{4}[/tex]

y = 2

The coordinates of C are (8,2)

What is the difference between the sum of the measures of the interior angles of a regular hexagon and the sum of the measures of the exterior angles of a regular pentagon

Answers

Answer:

180 degrees

Step-by-step explanation:

Other Questions
plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal? I do not breathe, but I run and jump. I do not eat, but I swim and stretch. I do not drink, but I sleep and stand. I do not think, but I grow and play. I do not see, but you see me every day. What am I? Both pieces of writing attacked the practices of the Catholic Church. Yet one led to a complete break, while the other did not. What in Luthers words seems uncompromising, and what in Erasmus words leaves more room for reform? What is the main function of the small intestine?(use terms : villi, surface area,blood capillaries,why must large molecules be broken down, high concentration and low concentration.) can anyone just explain how to do a distant rate time problems because I'm confused about them -4/9 divided by 2/3 what would the answer be? (First to answer gets brainiest)What three languages did theRosetta Stone, discovered in AncientEgypt, contain?A. Arabic, Baltic, and EnglishB. hieroglyphic, English and SomaliC. hieroglyphic, demotic and EnglishD. hieroglyphic, demotic and Greek What enrionmental factor can people with pku control to prevent building up extra phenylalanine in thier brains "God lends a helping hand to the man who tries hard". Justify the quote with reference to the lesson Weathering the storm in ersama Read and choose the correct option to complete the sentence.Antes de viajar el viernes, voy a ________ la ropa en la maleta. (1 point) aempacar bhacer cplanificar dpoder