The following data are available in monetary value: - buildings and structures
36,000; - machinery and equipment - 18,600; - spare parts for repair - 608; - raw materials and materials - 7020. The cost of fixed assets will be:


1) 64 258

2) 56 630

3) 57 238

4) 54 600

Answers

Answer 1

1

The answer is 1 because if u use your brain you'd understand

Answer 2

The cost of the fixed assets will be $64258. The correct option is 1.

What is an expression?

The mathematical expression combines numerical variables and operations denoted by addition, subtraction, multiplication, and division signs.

Mathematical symbols can be used to represent numbers (constants), variables, operations, functions, brackets, punctuation, and grouping. They can also denote the logical syntax's operation order and other properties.

Given that the data is, 36,000; - machinery and equipment - 18,600; - spare parts for repair - 608; - raw materials and materials - 7020.

The cost of the fixed assets will be calculated by adding all the values,

Cost = 36000 + 608 + 18600 + 7020

Cost = 62228 ≈ 64258

To know more about an expression follow

https://brainly.com/question/18365256

#SPJ2


Related Questions


Eileen is making lemonade with water and lemon concentrate. What percent of each mixture is
lemon concentrate?
a. The ratio of water to lemon concentrate is 3 to 1.
b. Eileen mixes 4 parts water for each part of lemon concentrate.
c. 4 out of every 5 cups of the mixture is water.

Answers

a) The percentage of lemon is 25%

b) The percentage of lemon is 20%

c) The percentage of lemon is 20%

What is a percentage?

The percentage is calculated by dividing the required value by the total value and multiplying by 100.

Example:

Required percentage value = a

total value = b

Percentage = a/b x 100

Example:

50% = 50/100 = 1/2

25% = 25/100 = 1/4

20% = 20/100 = 1/5

10% = 10/100 = 1/10

We have,

a)

Water : Lemon = 3 : 1

Percent of lemon concentrate:

= 1/4 x 100

= 25%

b)

1 part of lemon = 4 part of water

Percent of lemon.

= 1/5 x 100

= 20%

c)

Cups of lemon = 1

Cups of water = 4

Percent of lemon.

= 1/5 x 100

=  20%

Thus,

The percent of each answer is given above.

Learn more about percentages here:

https://brainly.com/question/11403063

#SPJ1

I NEED HELP ASAPPPPPP

Answers

Answer:

2.5

Step-by-step explanation:

m is the gradient

to find this we do the change in y/change in x

using the first 2 values we have been given:

change in y= 15-10

change in x= 4-2

5/2= 2.5

the gradient in 2.5

Twenty percent of U.S. adults have some type of mental illness. You randomly select 6 U.S. adults. Find the probability that the number of adults having some type of mental illness is:
a)exactly two
b)at least one
c)less than three
d)find the mean, variance, and standard deviation for this distribution

Answers

The mean is 1.2 ,variance is 0.96 and standard deviation of the given data is 96 square root.we can find all these data by using formula of probability.

what is probability?

Probability means possibility.It is a branch that deals with occurrence of random event.The value is given in the probability from 0 to 1.Probability is how likely something is to happen.It is  used in real life for analysis data.we can find probability to favorable outcomes divided by total outcomes.

What is difference between standard deviation and variation?

Standard deviation measures how far apart numbers are in a data set.Variance gives us the actual value to how much the numbers in a data set vary from the mean.The variance is equal to the square standard deviation and standard deviation is the square root of the variance.

NOW we have data

Person(ill)=20% =0.20        n=6

For Exactly two  p(x) =2

now we get  24.58% by using binomial theorem and putting value in the formula.

NOW for at least one p(x)>1  By putting value we get 0.7379.

Now for less than three p(x<30) we get 0.9011

Now to find mean

Mean=person (ill) multiply n

Mean = 0.20 * 6

Mean= 1.2

Variance= 1.2*0.80

             =0.96

IN the last we find standard deviation.it will be 96 square root.

To learn more about standard deviation and probability visit;

https://brainly.com/question/14935665

#SPJ4

A cake recipe asks for 1/4 cup of oil for each cake. How many cakes can be made from a bottle of oil that has 4 cups in it?

Answers

Answer: 16

Step-by-step explanation:

there are 4 1/4 in 1 cup. so it'll be 4 cakes for each cup of oil you have. multiply the number of cakes that can be made per cup (4) by the number of cups you have (4)

(4) x (4) = 16

Let S represent the number of randomly selected adults in a community surveyed to find someone with a certain genetic trait.The random variable S follows a geometric distribution with mean 4.66. Which of the following is a correct interpretation of the mean?answer choicesA value randomly selected from the distribution of S is expected to be 4.66.In repeated sampling from the distribution of S, the average of the values will approach 4.66.For a sample of values randomly selected from the distribution of S, the average of the sample will be 4.66.The probability is 0.66 that a value randomly selected from the distribution of S will be close to the mean.For a sample of values randomly selected from the distribution of S, the average of the sample will vary from the population mean by no more than 4.66.

Answers

Step-by-step explanation:

correct interpretation of the mean?answer choicesA value randomly selected from the distribution of S is expected to be 4.66.In repeated sampling from the distribution of S, the average of the values will approach 4.66.For

Write the complete proof in your paper homework and for online (only) complete the probing statement (if any) that is a part of your proof or related to it.
Given: BD ≅ BF
DE⊥BC
F K ⊥ AB
Prove: ED ≅ F K

Answers

The triangle ΔBHK and ΔBDE are congruent with each other. Then the side length ED is equal to the side length HK.

What is the triangle?

The polygonal shape of a triangle has a number of sides and three independent variables. Angles in the triangle add up to 180 °.

Replace F with H.

The triangles ΔBHK and ΔBDE are shown.

In triangles ΔBHK and ΔBDE, then we have

BD ≅ BH (Given)

∠HBK = ∠DBE (Common angle)

∠BHK = ∠BDE = 90° (Right angle)

The triangle ΔBHK and ΔBDE are harmonious with one another. Then, at that point, the side length ED is equivalent to the side length HK.

More about the triangle link is given below.

https://brainly.com/question/25813512

#SPJ1

determine whether the improper integral diverges or converges. evaluate the integral if it converges. 14/(x-8^2

Answers

Therefore ,the answer of this integration problem comes out to be  4/9.

Integrity, what is it?

To describe notions like displacement, area, volume, and other results of the combination of incredibly small inputs, an integral in mathematics imparts numerical values to functions. Integration is a method used in the process of integral discovery.

Here,

Given :

=>  [tex]\int\limits^9_7 {\frac{14}{(x-8)^{2} } } \, dx[/tex]

=> substitute x- 8 =u

=>du/dt =d(x-8)/dx = 1

=>du/dt =1

=> [tex]\int\limits^9_7 14{\frac{1}{(x-8)^{2} } } \, dx[/tex]

Substituting x- 8 =u

=> [tex]\int\limits^9_7 14{\frac{1}{(u)^{2} } } \, dx[/tex]

=> 14 [ [tex]\left \{ {{9} \atop {7}} \right. (\frac{-1}{u} )[/tex]  ]

=> 14( -1/9) + 1/7)

=> 14   ( ( 9 -7 ) / 63 )

=> 14 (2/63)

=> 28/63

=>4/9

Therefore ,the answer of this integration problem comes out to be  4/9.

To know  more about integration , visit

https://brainly.com/question/18125359

#SPJ4

A bus company took a tour bus on the ferry when there were 30 people aboard. The ferry charged the bus company $180. The following week, the bus had 50 people on board and the ferry charged them $220. How much is the "base rate" for the empty bus? hint: look at the difference between number of people and cost to get cost per person and then cost without people
How much does each person cost?
Write an equation to show cost, c, of a bus with x number of people on it

Answers

Answer:

Base rate: $120

Rate: $2 per person

Equation: f(x)=2x+120

Step-by-step explanation:

If 30 people cost $180 and 50 people cost $220, the charge for 20 extra people is $40.  This means, [tex]\frac{220-180dollars}{50-30people}=\frac{40dollars}{20people}=2\frac{dollars}{person}[/tex].

These values correspond to a base rate for the bus of $120.

The function for the cost per bus with x number of people on it would be:

[tex]f(x)=2x+100[/tex]

This can be checked by using the values given in the problem:

[tex]f(30)=2(30)+120=180\\f(50)=2(50)+120=220[/tex]

The base rate of $120 and $2 per person satisfies the given equation and established values.

Work out the surface area of this solid
prism.
10cm
8cm
27cm
6cm
17cm
30cm
The diagram is not drawn to scale.

Answers

Answer:

  2064 cm²

Step-by-step explanation:

You want the surface area of a prism that is 30 cm between bases that are trapezoids with parallel sides 27 cm and 6 cm that are 8 cm apart, and slant sides that are 10 cm and 17 cm.

Base area

The area of each trapezoidal base is ...

  A = 1/2(b1 +b2)h

There are two identical bases, so their total area is ...

  2A = (b1 +b2)h = (27 cm +6 cm)(8 cm) = 264 cm²

Lateral area

The lateral area of the prism is the area of the four rectangular faces. Each is 30 cm wide, and their total length is the perimeter of the base;

  P = 27 cm +10 cm +6 cm +17 cm = 60 cm

  lateral area = Ph = (60 cm)(30 cm) = 1800 cm²

Total surface area

The total surface area of the prism is the sum of the base area and the lateral area:

  total area = base area + lateral area

  total area = 264 cm² +1800 cm² = 2064 cm²

The surface area of the solid prism is 2064 cm².

Can someone do these 4 questions For 40 points

Answers

The gradient of the blue line as shown in the graph is 0.25

What is gradient?

The gradient of any line or curve tells us the rate of change of one variable with respect to another.

To calculate the gradient of the blue line, we use the formula below.

Formula:

S = Δy/Δx = (y₂-y₁)/(x₂-x₁)................. Equation 1

Where:

S = Gradient of the blue lineΔy = Change in y-axisΔx = Change in x-axis

From the graph,

Given:

x₁ = 0y₁ = 1x₂ = 8y₂ = 3

Substitute these values into equation 1

S = (3-1)/(8-0)S = 2/8S = 1/4S = 0.25

Hence, the gradient of the blue line is 0.25.

Learn more about gradient here: https://brainly.com/question/21727173

#SPJ1

Solve for m in the equation below. It may be helpful to convert the equation into exponential form. Write answer as an integer or reduced fraction. -2. log,(m) - 24 = - 20 m = > Next Question Find the largest value of 2 that satisfies: log, () – log (2 + 1) = 9 =

Answers

The largest possible value of 2 that satisfies the equation is approximately 1.1.

What is Exponential Form Equation?

Since y=bx, y = b x is a one-to-one inverse of the exponential function, x=by x = b y, it too is a function. We simply swap x and y and solve for y to discover the inverse function, as is the case with all inverse functions.

To solve for m in the equation -2 * log(m) - 24 = -20, we can start by converting the equation into exponential form. To do this, we can raise both sides of the equation to the power of e:

[tex]e^(-2 * log(m) - 24) = e^(-20)[/tex]

Then we can simplify:

[tex]m^(-2) = e^(-20)[/tex]

Then we can solve for m:

          [tex]m = sqrt[e^20]\\\\= sqrt[20*e^9]\\\\= sqrt[20] * sqrt[e^9]\\\\= 2 * 3^(1/2)= 2 * 1.732\\\\= 3.464[/tex]

So m is approximately equal to 3.464

To find the largest value of 2 that satisfies the equation [tex]log(2^2) - log(2 + 1) = 9[/tex],  we can start by expanding the left-hand side of the equation:

       [tex]log(2^2) - log(2 + 1) \\\\=log(2^2 / (2 + 1))\\\\ = log(4/3) = 9[/tex]

Then we can rewrite the equation as:

log(4/3) = 9

Then we can solve for 2:

         [tex]2 = (4/3)^(1/9)\\\\= (4^(1/9)) / 3^(1/9)\\\\= 1.5874010519681994 / 1.4422495703074083\\\\= 1.1[/tex]

So, The largest possible value of 2 that satisfies the equation is approximately 1.1.

To know more about Exponential Form Equation visit,

https://brainly.com/question/23275698

#SPJ4

Nine less than two times a number is five more than this number.

Answers

The statement as an expression is 2x - 9 = 5 + x

How to determine the statement as an expression?

From the question, we have the following statement that can be used in our computation:

Nine less than two times a number is five more than this number.

Express the numbers properly

So, we have the following representation

9 less than 2 times a number is 5 more than this number.

Introduce the equality symbols

So, we have the following representation

9 less than 2 times a number = 5 greater than this number.

Next, we apply the mathematical operators

So, we have the following representation

2 times a number - 9 = 5 + number.

Express the number as x

So, we have

2x - 9 = 5 + x

Hence, the expression is 2x - 9 = 5 + x

Read more about expressions at

https://brainly.com/question/15775046

#SPJ1

The art museum is 8 1/2 miles from Alison's house. Alison has ridden her bike 2/3 of the way there so far. How far has she gone?

Answers

Alison has traveled six miles on her bike.

What is the distance?

Distance is defined as the product of speed and time.

To find how far Alison has ridden her bike, we need to first convert 8 1/2 miles to miles as a mixed number.

We can do this by multiplying the fractional part of the mixed number by the denominator of the fraction:

8 1/2 miles = 8 miles + (1/2 x 2) miles = 8 miles + 1 mile = 9 miles

We can now multiply this distance by 2/3 to find how far Alison has ridden her bike:

9 miles x 2/3 = 6 miles

Therefore, she has ridden her bike 6 miles.

Learn more about the fractions here:

brainly.com/question/10354322

#SPJ1

The maximum weight, w, that an elevator can hold is 2200 pounds. Which inequality represents the situation?

Answers

Answer: w ≤ 2200 would represent the situation

Drag the tiles to the boxes to form correct pairs. Not all tiles will be used.

Determine which statements are the converse, inverse, and contrapositive of the following statement.

If a figure is a square, it is a polygon.​

Answers

Answer:

Step-by-step explanation:

For g(x) = 12x - 2, evaluate g (1).
A. -1
B. 1
C. 2
D. -2

Answers

Answer:

B

Step-by-step explanation:

g(x) = 12x - 2

g(1/4) = 12(1/4) - 2  ==> plug in 1/4 for x

g(1/4) = 12 * 1/4 - 2

g(1/4) = 12/4 - 2

g(1/4) = 3 - 2

g(1/4) = 1 ==> B

Answer:

Step-by-step explanation:

To evaluate g(1) for the function g(x) = 12x - 2, you can substitute the value 1 for x in the function:

g(1) = 12(1) - 2

g(1) = 12 - 2

g(1) = 10

Therefore, g(1) = 10. B

Can someone help me with this question????

Answers

Answer:

[tex]P = \boxed{\sf 4000}[/tex]

[tex]r=\boxed{\sf 0.03}[/tex]

[tex]n=\boxed{\sf 4}[/tex]

[tex]t=\boxed{\sf 5}[/tex]

Step-by-step explanation:

[tex]\boxed{\begin{minipage}{8.5 cm}\underline{Compound Interest Formula}\\\\$ A=P\left(1+\frac{r}{n}\right)^{nt}$\\\\where:\\\\ \phantom{ww}$\bullet$ $A =$ final amount \\ \phantom{ww}$\bullet$ $P =$ principal amount \\ \phantom{ww}$\bullet$ $r =$ interest rate (in decimal form) \\ \phantom{ww}$\bullet$ $n =$ number of times interest is applied per year \\ \phantom{ww}$\bullet$ $t =$ time (in years) \\ \end{minipage}}[/tex]

If you invest $4,000 then the principal amount is $4,000.  As P represents the principal amount:

[tex]\implies P = \boxed{\sf 4000}[/tex]

The interest is 3%.  3% = 3/100 = 0.03.  Therefore:

[tex]\implies r=\boxed{\sf 0.03}[/tex]

"n" represents the number of times interest is applied per year.  

Therefore, if the interest is applied quarterly then:

[tex]\implies n=\boxed{\sf 4}[/tex]

"t" represents the time in years.  Therefore, if you plan to leave the money in the account for 5 years then:

[tex]\implies t=\boxed{\sf 5}[/tex]

-----------------------------------------------------------------------------------------

To calculate the amount in the account after 5 years, substitute the values into the formula and solve for A:

[tex]\implies A=4000\left(1+\dfrac{0.03}{4}\right)^{4 \times 5}[/tex]

[tex]\implies A=4000\left(1+0.0075\right)^{20}[/tex]

[tex]\implies A=4000\left(1.0075\right)^{20}[/tex]

[tex]\implies A=4000(1.16118414...)[/tex]

[tex]\implies A=\$4644.74[/tex]

1/4+1/6 in fractions
Please help me I’m giving you 25 pints things

Answers

Write common denominator

3+2/12

Answer: 5/12
5/12

Step by step:
1)Find the LCM of 6 and 4 =12
2)set both fractions to over 12 and do whatever you done to the bottom to the top
3)1x3=3 1x2=2
4)3+2 =5
Answer: 5/12

A student receives a subsidized student loan for $10,000 with a 10-year repayment term and interest compounded monthly. Six months after she graduates from college, she will have to begin making payments. Find her monthly payment and total interest paid if the interest rate is 5.5%.

Answers

If the interest rate is 5%, the monthly payment and total interest would be $2.439.

Define interest.

Interest is the sum of money that must be repaid on a loan or received in exchange for a loan. Principal refers to the borrowed or lent funds. The Amount is the total of the principal plus interest. The term "rate of interest" refers to the rate at which interest is applied to the principal.

Given,

A student receives a subsidized student loan for $10,000 with a 10-year repayment term and interest compounded monthly. Six months after she graduates from college, she will have to begin making payments.

A $10,000 subsidized student loan

Ten-year term of repayment

5.5% interest rate

First, we must determine the loan's future value (FV) over the next six months using the formula below:

FV in 6 months

= Loan Amount× (1 + Interest Rate)⁶ ($10,000×(1 + 0.055) ×6

= $2.7680.

Second, the formula for determining future value is used to determine the monthly payment:

M = FV in 6 months / (((((r)n) - 1) / r).......... (1)

When you enter all the pertinent values into equation (1), you get:

M = $2.7680 / ((((1 + 0.00466666666666667)^144) – 1) / 0.00466666666666667)

M = $2.439

Therefore, if the interest rate is 5.5%, the total amount paid in interest plus monthly payments would be $2.439.

To learn more about interest, visit:

https://brainly.com/question/28792777

#SPJ1

Graph by finding the x and y intercepts using a table

-3x-6y=0

Answers

Answer: see below

Step-by-step explanation:

x=0 -3(0)-6y=0 -6y=0 y=0

x=1 -3(1)-6y=0       -4-6y=0    -6y=4      y=4/6 or 2/3

x=2 -3(2)-6y=0      -6-6y=0      -6y=6    y=-1    

x=3 -3(3)-6y=0         -9-6y=0        -6y=9       y= -9/6   or -3/2

x=-1 -3(-1)-6y=0          3-6y=0           -6y=-3       y=1/2  

x              y

-1               1/2

0              0

1               -2/3

2              -1

3             -1 1/2

You need a $12,000 loan to buy a good used car. Your bank offers a 3-year loan with an APR of 5% and a 5-year loan with an APR of 8%. Find the monthly payment and total interest paid for each loan option. Which would you choose? What is the better deal?

Answers

In case of APR 5% total payment made is $12,947.42 and in case of APR 8% total payment made is $14,598.94. Therefore the better deal to choose to pay the less payment is 1st case.

Define APR.

APR is the annual interest produced by a sum that is paid to investors or charged to borrowers is referred to as the annual percentage rate (APR). This does not account for compounding and includes any fees or additional expenditures related to the transaction. Consumers can evaluate lenders, credit cards, or investment goods using the APR as a benchmark figure.

Initial payment is $12,000 with 5% APR and 3 year loan

Monthly payment = P[ i(1+i)ⁿ] / [(1+i)ⁿ-1]

= 12,000[0.05(1+0.05)³]/[1+0.05)³-1]

=$359.65

Over 36 payments total payment is $12,947.42

And in case of 8% APR with a  5 year loan

Monthly payment = 12,000[0.08(1+0/08)⁵] / [(1+0.08)⁵-1]

=$243.31

Over 60 payments total payment is $14,598.94

So, the best deal is 5% APR with a 3 year loan.

To know more about APR visit:

https://brainly.com/question/14184570

#SPJ1

Find the average rate of change of g (x)=-2x³ +5x² from x=2 to x = 3.
Simplify your answer as much as possible.

Answers

The average rate of change of g (x)=-2x³ +5x² from x=2 to x = 3 is

a(x)= -13

What is meant by average rate of change?

It represents the average change in the function's per-unit value during that time period. On the function's graph, it is generated from the slope of the line connecting the interval's ends. Following is the formula for the average rate of change:

a(x) = [f(b) - f(a)]/(b - a)

where,

a(x) = Average Rate of Change

f(a) = Function Value at a

f(b) = Function Value at b

Given,

g (x)=-2x³ +5x² from x=2 to x = 3

Average rate of change is a(x)

g (x)=-2x³ +5x²

Put x=2 in the above equation

g(2)= -2(2)³+5(2)²

= -16+20

=4

g(2)=4

Now, put x=3 in the above equation

g(3)= -2(3)³+5(3)²

= -57+45

= -9

We know that,

Average rate of change a(x)= (g(b)-g(a))/(b-a)

a(x)= g(3)-g(2)/(3-2)

a(x)= (-9-4)/1

a(x)= -13

Therefore, the average rate of change a(x)= -13

To know about average rate of change, visit:

https://brainly.com/question/28744270

#SPJ1



Aaliyah invests $7,000.00 at 4% simple interest for 1103 days.


How much interest is earned over the 1103 day period?

The interest earned over the 1103 day period is _______

How much is in the account at the end of the 1103 day period?

Aaliyah will have __________
in the account at the end of the 1103 day period.

Answers

The interest earned over the 1103 day period is $840

Aaliyah will have $7840 in the account at the end of the 1103 day period.

What is simple interest?

Simple interest is defined as the amount of money that is paid to an individual following an investment that is made to an account.

The amount of money invested = $7,000.00

The rate of interest= 4%

The time of investment = 1103 = 3 years

Simple interest = P×T×R/100

= 7000×4×3/100

= 84000/100

= $840

The amount of money that is in the account at the end of the 1103 day period = 7000 + 840 = $7,840

Learn more about simple interest here:

https://brainly.com/question/25793394

#SPJ1

Can someone evaluate these for me
1×(– 6 × –18 –8) ÷4
4– – 20+ – 5 ×( –11 – –18)
13– – 10 × 16 ÷ (14 + –16)
1– – 9 × 12 ×(–19 +20)

Answers

The answer of the given expression using BODMAD rule is 25.

What is BODMAS rule?

The BODMAS rule states that the brackets must be solved first, then powers or roots (i.e., of), Division, Multiplication, Addition, and finally Subtraction. Only when the BODMAS rule or the PEDMAS rule is used to solve an expression is the solution deemed to be correct.

(a) 1 x (-6 x -18 - 8) ÷ 4

By using first to simplify the bracket.

1 x ((-6 x -18) - 8) ÷ 4

1 x (108 - 8) ÷ 4

(1 x 100) ÷ 4

100 ÷ 4

25

Hence, the answer of the given expression using BODMAD rule is 25.

To know more about the BODMAS rule, click on the link

https://brainly.com/question/29626868

#SPJ1

PLEASE HELP IM TIMED I WILL GIVE BRAINLIST!!!!!!!!

Answers

The distance between the line segments PQ, RS and TV are √53 respectively

Distance Between Two Points

The distance between any two points is the length of the line segment joining the points. There is only one line passing through two points. So, the distance between two points can be calculated by finding the length of this line segment connecting the two points.

The formula is given as;

d = √(x₂ - x₁)² + (y₂ - y₁)²

In the first line segment;

P = (0,4), Q = (7, 2)

d = √((7-0)² + (2 - 4)²)

d = √53

b)

R = (-7, 6), S = (-5, -1)

d = √((-1 - 6)² + (-5 --7)²)

d = √53

c)

T = (0, -8), V = (2, -1)

d = √((-1 --8)² + (2 - 0)²)

d = √53

The distance between the lines are all √53 units

Learn more on distance between two points in a line segment here;

https://brainly.com/question/7243416

#SPJ1

Algebraically prove that x^3 + 9 / x^3+8 = 1 + 1/x^3 +8 , where x ≠ -2

Answers

Refer to the photo taken.

358.584 divided by 8.92 using mental math and the division algorithm

Answers

Answer:

Below

Step-by-step explanation:

358.584 is about 360      8.92 is about 9

360 / 9 = 40 approx   by' doing it in your head '

ACTUAL answer = 358.584/8.92 = 40.2   Pretty darn close !

Using the income statement below, calculate the following profitability ratios for Western Bookkeeping and Tax Service. Assume that stockholder's equity equals $441,600 and total assets equal $640,000.
Profit margin ratio
Return on equity ratio
Asset turnover ratio
Write the profit margin and return on equity ratios as a percent, rounded to the nearest percent. Write the asset turnover ratio as a decimal, rounded to two decimal places.

Answers

The computation of the profitability ratios for Western Bookkeeping and Tax Service is as follows:

Profit margin ratio = 8%Return on equity ratio = 8%Asset turnover ratio = 0.75.

What are profitability ratios?

Profitability ratios are the financial ratios that evaluate an entity's ability to convert its earnings (revenue) into profit versus different criteria.

Some of the common profitability ratios include:

Gross Profit MarginOperating Income RatioNet Income RatioReturn on Investment (ROI)Return on EquityReturn on Total AssetsAsset turnover RatioEarnings per share.

Stockholders' equity = $442,600

Total assets = $640,000

Net sales = $480,000

Net income = $36,000

Profit margin ratio = Net income/Net Sales x 100

= $36,000/$480,000 x 100

= 7.5%

= 8%

Return on equity ratio = Net income/Shareholders' Equity x 100

= $36,000/$442,600 x 100

= 8.13%

= 8%

Asset turnover ratio = Net Sales/Total Assets

= $480,000/$640,000

= 0.75

Learn more about the profitability ratios at https://brainly.com/question/16750058

#SPJ1

A tortoise and a hare are competing in a 2000-meter race. The arrogant hare decides to let the tortoise have a 820-meter head start. When the start gun is fired the hare begins running at a constant speed of 7.5 meters per second and the tortoise begins crawling at a constant speed of 4.5 meters per second.
a. Write an expression in terms of t that represents the hare's distance from the starting line (in meters)
b. Write an expression in terms of t that represents the tortoise's distance from the starting line (in meters).
c. Write an expression in terms of t that represents the number of meters the tortoise is ahead of the hare.

Answers

a. The hare's distance from the starting line is represented by the expression 7.5t.

b. The tortoise's distance from the starting line is represented by the expression 4.5t+820.

c. The number of meters the tortoise is ahead of the hare is represented by the expression 4.5t+820-7.5t.

In the race, the hare is running at a constant speed of 7.5 meters per second, so their distance from the starting line is equal to their speed multiplied by the time it takes them to run that distance. This is represented by the expression 7.5t, where t is the time in seconds it takes the hare to run.

Similarly, the tortoise is crawling at a constant speed of 4.5 meters per second, so their distance from the starting line is equal to their speed multiplied by the time it takes them to crawl that distance, plus the 820-meter head start they were given. This is represented by the expression 4.5t+820, where t is the time in seconds it takes the tortoise to crawl.

To find the number of meters the tortoise is ahead of the hare, we subtract the hare's distance from the starting line from the tortoise's distance from the starting line, which gives us the expression 4.5t+820-7.5t.

Learn more about Linear Expressions here:

https://brainly.com/question/25682757

#SPJ4

One factor of the function f(x) = x3 − 6x2 + 11x − 6 is (x − 3). Describe how to find the x-intercepts and the y-intercept of the graph of f(x) without using technology. Show your work and include all intercepts in your answer

Answers

One factor of the function f(x) = x3 − 6x2 + 11x − 6 is (x − 3). the x-intercepts and the y-intercept of the graph of f(x) are

x = 2, x = 3, and x = 4.(0, -6), (2, 0), (3, 0), and (4, 0). Respectively

What are the x-intercepts?

Generally, To find the x-intercepts, we set y equal to 0 and solve for x. In this case, the equation we need to solve is:

f(x) = x^3 - 6x^2 + 11x - 6 = 0

To solve this equation, we can use the fact that (x - 3) is a factor of the function. This means that we can write the function as:

f(x) = (x - 3)(x^2 - 3x + 2)

If (x - 3) is a factor, then x - 3 must equal 0. This gives us one x-intercept at x = 3.

To find the other x-intercepts, we can set the quadratic factor (x^2 - 3x + 2) equal to 0 and solve for x. This gives us the following equation:

x^2 - 3x + 2 = 0

We can use the quadratic formula to solve this equation:

x = (3 +/- √(9 - 8)) / 2 = (3 +/- √(1)) / 2 = (3 +/- 1) / 2

This gives us two more x-intercepts at x = 2 and x = 4.

So the x-intercepts of the graph of f(x) are x = 2, x = 3, and x = 4.

To find the y-intercept, we set x equal to 0 and solve for y. In this case, the equation we need to solve is:

f(0) = 0^3 - 6(0)^2 + 11(0) - 6 = -6

This gives us a y-intercept at (0, -6).

So the y-intercept of the graph of f(x) is (0, -6).

All of the intercepts of the graph of f(x) are, therefore (0, -6), (2, 0), (3, 0), and (4, 0).

Read more about x-intercepts

https://brainly.com/question/14180189

#SPJ1

Other Questions
Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by?