the qualifications for becoming president are set forth by

Answers

Answer 1

Answer:

No person except a natural born citizen, or a citizen of the United States, at the time of the adoption of this Constitution, shall be eligible to the office of President; neither shall any person be eligible to that office who shall not have attained to the age of thirty five years, and been fourteen Years a resident .

Hope it helps :)


Related Questions

What is the Paradox of aging?

Answers

The paradox of aging is research shown that we grow happier as we get older

Answer:

The paradox of aging is when people feel happier and more calm as they get older and experience less stress, worry and anger.  

Hope this helps :)

( pls mark brainliest )

What factors contributed to the military coup in Ghana? corruption and economic problems growth in the oil industry and election fraud ethnic tensions and laws restricting political freedom the Pan-African movement and the Mau Mau uprising

Answers

The Coup in Ghana happened as a result of ethnic tensions and laws restricting political freedom.

Ghana went through a coup because:

Kwame Nkrumah was becoming increasingly dictatorial Ethnic tensions were becoming more widespread

As a result of these, several leading figures in the country decided to overthrow Kwame Nkrumah in 1966 in what was Ghana's first coup.

In conclusion, the coup happened because Ghana was becoming a dictatorship and ethnic tensions were brewing.

Find out more on this at https://brainly.com/question/512810.

What does the x/y pair of chromosomes determine in human

Answers

Answer:

Normally, each cell in the human body has 23 pairs of chromosomes (46 chromosomes in all), of which half come from the mother and half from the father. Two of the chromosomes (X and Y) determine male or female gender and are called sex chromosomes: Women have 2 X chromosomes.

Explanation:

i'm mexican

In this poem, seemingly "nonsense words" like "Jabberwock," "Bandersnatch," and "Tumtum" are capitalized. This indicates that

plz help

Answers

Answer:

Its is the first one

Explanation:

Answer:

It Indicates that these are names of either a person or place.

Explanation:

What do people expect from democracy? ​

Answers

Answer:

People expect to be listened to so that laws can be changed to suit their needs. People are happy voting for political stuff since it gives everyone a voice no matter who you are or what you look like. Democracy is the right to vote.

Hope that helps. x

Explain why bills die in the process?

Answers

Answer:

Since the volume of bills is so large, most bills today are sent directly to subcommittee. Most bills — about 90% — die in committee or subcommittee, where they are pigeonholed, or simply forgotten and never discussed.

Explanation:

Healthy ways of coping with stress include developing refusal skills, getting sleep, and planning ahead. Please select the best answer from the choices provided. T F Mark this and return

Answers

Answer:

it true i just took the testttttttt

Explanation:

Why is it dangerous to wear contact lenses in the lab?

Answers

Answer:

Chemical vapors may penetrate the contact lens material and cause the lens to adhere to one's eye.

Explanation:

in order to classify information the information must concern

Answers

Answer:

To be classified or maintained as classified, information must meet all of the following criteria EXCEPT: The unauthorized disclosure of the information could cause embarrassment to the U.S. Government. The Security Classification Guide (SCG) states: The dates of the training exercise are Secret.

how many companions can you have in fallout new vegas?

Answers

Bring your friends who you consider like good friends. If you are trying to have a good time I would bring like 6 or 4 people. Others would possible want to have up to two legitimately acquired companions in the party.

Answer:

you can heve 2 in a farty at a time 1 humanoid 1 animal or robot

Explanation:

how many father-son pairs have won the same tournament?

Answers

It's was supposed to be three but I think it's has changed now

The three father-son pairs have won the same tournament.

What is tournament?

A tournament is a competition or contest in which individuals or teams compete against each other in a series of matches or games to determine a winner. Tournaments are common in a wide range of sports, including soccer, tennis, basketball, and golf, as well as in games like chess and poker. Tournaments can be formal or informal

Tournaments typically involve a single-elimination format, in which participants are paired off in matches, with the winner advancing to the next round and the loser being eliminated. The final round features the last two remaining participants or teams, who compete to determine the overall winner.

The pairs of father-son that have won the same tournament is three.

.

Learn more about tournament here:

https://brainly.com/question/16726441

#SPJ6

Information can be overlearned if one continues to practice it after it has been mastered. Please select the best answer from the choices provided T F.

Answers

The statement which states that "Information can be overlearned if one continues to practice it after it has been mastered" is:

False

According to the given question, we are asked to show whether the given statement about whether Information can be overlearned if one continues to practice it after it has been mastered is true or false.

As a result of this, we know that information is gotten when a person learns a new thing and reinforces this knowledge by subsequent study of the particular knowledge.

However, information cannot be "overlearned", even after a person continues to practise it after it has been mastered because one cannot overlearn information.

Read more about information here:

https://brainly.com/question/24621985

Answer:

True !

Explanation:
Think of it being "excessive learning". The information is already processed in your brain so there's no reason to learn it again or practice. But going beyond is simply just overlearning a concept you already understand.

If you are unsure whether someone is an adult or child, provide emergency care as if the person is ________________________.

Answers

Answer:

an adult

Explanation:

Generally, children are definitely more sensitive individuals and require different measures to be taken. Logically, treating an adult as a child might seem like a safe thing as one might take more precautions with the child.

IN CPR it's the contrary: Children have stronger pathways that are essential for CPR when compared to adults. Therefore, Children are always more likely to survive a CPR. If we treat the person like they are an adult, we are taking more precautions and they then have a higher chance of surviving.  

how many full time chefs does the white house have

Answers

Answer: five full-time chefs
With five full-time chefs, the White House kitchen is able to serve dinner to as many as 140 guests and hors d'oeuvres to more than 1,000. The White House requires 570 gallons of paint to cover its outside surface.

White House facts: The White House has 412 doors and 147 windows. The White House has 3 elevators and 8 staircases. The White House has a bowling alley (one lane), movie theater, tennis court, putting green and a swimming pool. There are three major sections of the White House, the West Wing, the East Wing and the Residence.

Answer: The White house has 5 full time chefs.

Explanation:

example situation of turn taking communicative strategy

Answers

Communication strategy refers to different way of sharing information to achieve a particular purpose.

The type of communication strategy includes:

NominationRepairRestrictionTerminationTopic ShiftingTopic ControlTurn-taking

The communication strategy of turn taking pertains to when people decides who take the conversational floor and give all communicators a chance to speak.

A very good example of turn taking communicative strategy is when one say "I'm have been talking since, it's your turn to talk now"

Read more about Communication strategy

brainly.com/question/10869544

Individuals with a high self-esteem are more likely to ___________ than those with a low self-esteem.

Answers

Answer: Succeed. Individuals low self esteem are less likely to achieve what they want to than those with high self esteem, as those with low self esteem do not believe they can accomplish those things.

throughout most of human history, families had many children because

Answers

Answer:

children were a source of labor, birth control was unreliable and high death rates meant that reaching adulthood was rare

A cultural icon can be a:

a. significance
b. representation
c. symbol
d. idea

Answers

Representation

The cultures use cultural icons to represent themselvesThe cultural icons make them unique among other cultures.That defines how they appear to the world

PLZZ HELP,
Best answer gets brainliest!

To _____________ means to resemble or become part of a whole.

assimilate
segregate
compel
prosper

Answers

Answer:

Assimilate

Explanation:

Sometimes referred to as "McCain-Feingold,' the Bipartisan Campaign Reform Act of 2002 (BCRA) hoped to regulate the financing
of political campaigns. Which of these was a major issue addressed by BCRA?
A)
overturning the Federal Election Campaign Act of 1974
B)
diminishing the influence of soft money in campaigns
G
CO
overturning the ruling in Citizens United v. FEC
)
D)
lessening the impact 'iron triangles' have on the political process

Answers

Hello! Your answer is B) diminishing the influence of soft money in campaigns.
The answer is B, so he’s right

okmarks
Review: Ecology Cumulative Concept Check
POSS
Yorest Food Web
Acorns, butterflies, wildflowers and grasshoppers are all producers.
O True
O False

Answers

I’m thinking it’s true cause the question lol

what can you conclude about gregor mendel from the information presented in the movie?

Answers

Answer:

He was one of the first researchers to understand how heredity works.

Explanation:

what best descibes geroge washington's main military strategy?

Answers

Answer:

I don't know

Explanation:

What aspects are included under tje ‘Right to Equality ’ in the constitution of nepal ?​

Answers

These include freedom to live with dignity, freedom of speech and expression, religious and cultural freedom, right against untouchability and discrimination

which pharaoh ordered the construction of the abu simbel

Answers

Answer:

Ramses ll

Explanation:

Did the Maya empire make fewer human sacrifices than the Aztecs and the Inca?

Answers

Answer:

Yes The Aztecs led a more brutal, warlike lifestyle, with frequent human sacrifices, whereas the Maya favoured scientific endeavours such as mapping the stars.

Explanation:

1. The person who...................... motherland deserves respect and support in every walk of life. (loves/hates) 2. Sky diving, bungee jumping, paragliding, rafting &kayaking etc are some...............the visitors can enjoy in Nepal. (traditional sports/ adventure sports) 3. Preservation of the historical and cultural sites is our................ (identity/duty) ​




this is only fill in the blank

Answers

Answer:

(1) Loves (2) Traditional sports (3) duty

Explanation:

(1) I think it is loves because the person who loves something deserves to be respected.

(2) Nepal has a lot of water so the things listed below would be found very common.

(3) Identity means who you are while duty means it is your right.

I hope this helps

one premise of the national response framework is tiered response

Answers

Answer: Incidents should be managed at the lowest possible jurisdictional level and supported when needed

Explanation:

which country first introduced a red, white, and blue tricolor flag?

Answers

Answer:

Explanation:

The flag of the Neverlands

learning by observing and imitating others is called

Answers

Observational learning? (it also depends on what you're learning)
Other Questions
Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus Johnny has a box filled with 10 black marbles and 5 purple marbles.What are the odd he pulls two purple marbles in a row without replacemnet 3. Solve the formula A = 1/2 (b1+ b2))h for h. Show your work. The Silk Road was specifically developed to _____________. If you _____________ your homework before dark, I will take you to the mall. finish had finished will finish finished hiil have some dought Based on the passage, insulators and conductors differ inAthe number of protons they have.Bthe way they allow or resist the flow of electricity.Cthe way they allow or resist the movement of neutrons.Dhow much mass their atoms have. As you read lines 1-38 of "Who Understands Me But Me, begin to collect and cite text evidence. . a. Identify each thing the speaker lives without in lines 1-16. b. Explain what setting the speaker evokes in lines 1-16. c. Explain what the speaker finds when he follows the tracks (lines 30-38). who killed eren yeager Market for flat-screen TVs:Demand: Qd=2,600-5PSupply: Qs=-1000 +10PWhat would be the amount of shortage if a price ceiling is imposed at price of $205?Your Answer: 1100Answer