They confessed their guilt.​

Answers

Answer 1

Answer:

heyyy

May I Know the full question

Answer 2
That’s not a question???? What’s the question

Related Questions

What is the mass of an object which has a momentum of 560 kg m/s and is traveling at 15 m/s?

Answers

Answer:

plane

Explanation:

Can anyone help me. . .

Answers

Answer:

welll

Explanation:

i honestly dk

You may have noticed that there was a big difference in the results of
the two hollow pipe experiments, but very little difference in the solid chunk experiments.
Why do you think this was the case?




ANSWER QUICK PLS!

Answers

Answer:

For conduction you don't need position. For convection you do.

Explanation:

you just needed to look it up LOL <3

if a 60 kg person was standing on a platform at the surface of saturn and they jumped, they would have to push with a force greater than..?

Answers

Answer:

A 60 kg person standing on a platform at the surface of Saturn and they jumped, they would have to push with a force greater than 540 N

Explanation:

The gravitational attraction between an object on the surface of a planet and the planet is given by the weight of the object

Therefore the force needed to be applied for an object to lift off the surface of a planet = The weight of the object

The weight of the object on the surface of a planet = m × g

Where;

m = The mass of the object

g = The strength of gravity on the planet's surface in N/kg

The given parameters are;

The mass of the person standing on a platform at the surface of Saturn, m = 60 kg

The strength of gravity on the surface of Saturn = 9 N/kg

Therefore, we have;

The weight of the person = The force greater than which the person would have to push on the surface of Saturn so as to Jump = The weight of the person on the surface of Saturn = 60 kg × 9 N/kg = 540 N

Therefore, for a 60 kg person standing on a platform at the surface of Saturn and they jumped, they would have to push with a force greater than 540 N.

1. Place these unknown pH test papers in order from most acidic to most alkaline.
А в
C D
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
pH color chart
A. Paper D. paper C, paper B, paper A
B. Paper B, paper A, paper C, paper D
C. Paper C, paper D, paper A, paper B
D. Paper D, paper C, paper A, paper B

Answers

Answer: B

Explanation: look at the chart, easy

Answer:

D

Explanation:

After completing an experiment, all chemical wastes should be

Answers

Answer:

The correct answer is

C. disposed of according to your instructor’s directions

Explanation:

The question is not complete here is the complete one with options to choose from

After completing an experiment, all chemical wastes should be

A. taken home

B. dumped in the sink

C. disposed of according to your instructor’s directions

D. left at your lab station for the next class

30 Joules of energy enter a light bulb. 20 joules of energy are transformed into light; how much energy is dissipated as heat?

Answers

Answer: 10 Joules will be dissipated as heat.

When an old building is to be torn down, Mr. Pham’s company removes the bricks, cleans off the mortar from the bricks, and then sells the bricks to companies that restore historic buildings. Which compound is Mr. Pham’s company most likely to use in its work?

hydrochloric acid
nitric acid
sodium hydroxide
lithium hydroxide

Answers

Answer:

hydrochloric acid

Explanation:

The compound Mr. Pham's company used is most likely hydrochloric acid.

Hydrochloric acid is a strong acid and it is applied to remove corrosion and rusts from another body.

For industrial purposes, they are used as cleansing agents.

The acid is capable of dissolving and breaking down the rust and corrosion.

A base does not have this property and would not effectively remove the corrosion.

Sodium hydroxide and lithium hydroxide are bases.

Nitric acid is not as strong as hydrochloric acid.  

Answer:

hydrochloric acid

Explanation:

i just did the test 3 minutes ago.

hope this helps and have a good day.

:)

A 735 kg object and a 1.37×1012 kg are located 2.59×104 m away from each other. What is the force due to gravity between the two objects?

Answers

Answer:

Fg=1.02*10^-4 N

Explanation:

Fg=Gm1m2/r^2

help plzzzzzzz i need thissssssssss

Answers

Answer:

The final graph

Explanation:

The graph that curves downwards is negative acceleration. While the position decreases the slop increases.

A statue of a great baseball player weighs 2400 N and has a base that is 4 m x 2 m. What is the pressure the statue exerts on the floor?

Answers

Answer:

300N/m²

Explanation:

Pressure is calculated using the formula;

Pressure = Force/Area

Given

Force = 2400N

Area = 4m×2m = 8m²

Substitute the given parameters into the formula as shown;

Pressure = 2400/8

Pressure = 300N/m²

Hence the pressure the statue exerts on the floor is 300N/m²

WORTH 50 POINTSSSS!!!!!!!! don't lie either if you do I will report your answer and get my points back idc !!!!!!

This political cartoon summarizes proposed legislation to stop immigration into the United States through the use of

A. Income


B. Military force


C. Building a barrier wall


D. Educational requirements

Answers

Answer:

C is the correct answer and i hope ur having a good day UwU

Explanation:

HELP PLEASE FOR BRAINLIEST!

Find the volume of an object with a density of 3.1 g/mL and a mass of 12 g.

Answers

Answer:

Density = Mass/Volume => Volume = Mass/Density = 12/3.1 = 3.87ml

Explanation:

Answer:

3.9 mL

Explanation:

To find the volume of an object using its mass and density, we can use the following formula:

Volume = Mass/Density

Volume = 12/3.1

Volume ≈ 3.9

Therefore, the volume of the object is 3.9 mL.

I hope this helps!

Pls Solve this!!!Im giving 20 points and Brainliest to the one who answers first. HELP ME PLEASE!!!!!!!!

Answers

Answer:

i) 2Mg + O₂ + Δ Heat → 2MgO + Δ Energy

ii) The aqueous solution does not change in the color of the blue litmus paper and the blue litmus paper remains blue in color

The aqueous solution formed using the product (MgO) turns the red litmus paper blue

Explanation:

i) Magnesium easily burns in air or oxygen when heated to form a white powder of magnesium oxide. The burning (reaction) of magnesium in air is an exothermic reaction that involves the release of heat and light

The burning of magnesium wire is given by the following chemical reaction;

2Mg + O₂ + Δ Heat → 2MgO + Δ Energy

ii) When magnesium oxide is mixed with water if forms magnesium hydroxide Mg(OH)₂ as shown in the following chemical reaction;

MgO + H₂O → Mg(OH)₂

Magnesium hydroxide is basic and therefore it will turn red litmus paper blue and it does not change the color of the blue litmus paper.

A family is skating at an ice rink. The 58.2 kg mother is holding the
hand of her 35.5 kg daughter. The father grabs his wife's free hand and pulls horizontally with a constant force of 100. N. Assume that the skates glide without friction on the ice and that the family's hands andarms approximate ideal strings. How much net force does the daughter experience?

Answers

Answer:

When I got this question I had to draw it out so if you have to do that, draw 3 stick figures holding hands, one representing the mother, father, and daughter. Then you write their weights on top of them and then draw an arrow pointing from the father to the mother.

Explanation:

use this formula :

[tex]a_{y}[/tex] = [tex]\frac{Fdadshandy}{msys}[/tex]

then you fill it in :

[tex]a_{y}[/tex] = [tex]\frac{100N}{35.5kg+58.2kg}[/tex]

[tex]a_{y}[/tex] = [tex]\frac{100N}{93.7kg}[/tex]

[tex]a_{y}[/tex] = [tex]1.0672[/tex] [tex]m/s^{2}[/tex]

then you multiply that with the daughters weight :

[tex]T_{2} x= m_{2} a_{y}[/tex]

[tex]T_{2} x = 35.5kg (1.0672 m/s^{2})[/tex]

[tex]T_{2} x = 37.89N[/tex]

and that's the answer :) : 37.89N

a high school physics student with a mass of 68.18 KG is sitting in a seat reading this question the magnitude of the force with which the seat is pushing up upon the student is

A) 6.96 N

B) 66.82 N

C) 668.16 N

D) 1200 N

Answers

The answer to the question is C

6. List three behaviors of light that support the theory that light travels in waves.
Then describe and/or draw each behavior.

Answers

Answer:

Light has the unique property that it can be described in physics as both a wave and as a stream of particles called photons

Explanation:

Answer:

Light has the unique property that it can be described in physics as both a wave and as a stream of particles called photons

Explanation:

Metamorphic rock occurs when you take any other type of rock and put them under ________ and ______________, and they twist and meld together.

Answers

Answer:

This question appear incomplete

Explanation:

This question appear incomplete because of the absence of options. However, metamorphic rocks are rocks that are formed from other pre-existing rocks under heat and pressure (both are usually high), causing them to twist and melt together. Metamorphism simply means a change in form of something and that's what happens here also.

Please Help Me!!!!!!​

Answers

Answer: B

Explanation: It states they have the same mass so the eliminates the majority of the answers. Density = mass/volume so if sample A & B have the same mass but A is heavier that means A has more volume than sample B

PLEASE ANSWER FAST
Calculate the density of an object with a mass of 15.6 grams and a volume of 2 cm3

Answers

Given :

Mass of object, m = 15.6 grams.

Volume of object, V = 2 cm³.

To Find :

The density of the object.

Solution :

We know, density of an object is given by :

[tex]\rho = \dfrac{m}{V}\\\\\rho = \dfrac{15.6}{2}\ grams/cm^3\\\\\rho = 7.8\ grams/cm^3[/tex]

Hence, this is the required solution.

5) A car travels 150 km in 2 hours. What is its speed?
(Show the correct units.)

Answers

Answer:

75km/hr

Explanation:

distance(d)=150km

time(t)=2hours

speed=distance/time

=150/2

=75km/hr

If 100.0 g of a substance releases 45 kJ of energy as it cools from 13.0°C to –15.0°C, what is the specific heat capacity of the substance?

Answers

Answer:

16,071.42J/kgK

Explanation:

The formula for expressing the quantity of heat released is expressed as;

Q = mcΔt

m is the mass of the substance = 100g - 0.1kg

c is the specific heat capacity of the substance

Δt is the change in temperature = 13 -(-15) = 28°C

Substitute and get c;

45000 = 0.1c(28)

2.8c = 45000

c = 45000/2.8

c = 16,071.42J/kgK

Hence the specific heat capacity of the substance is 16,071.42J/kgK

What is the momentum of a two-particle system composed of a 1400 kg car moving east at 70 m/s and a second 1300 kg car moving west at 85 m/s? Let east be the positive direction and answer to 3 significant figures.

Answers

Answer:

209000 kg*m/s

Explanation:

Momentum is caclucated using the equation P=mv. Where m is mass and v is velocity.

If you are required to show your work it would be the following:

1400*70=98000 kg*m/s

1300*85=110500 kg*m/s

98000+110500=208500 kg*m/s

209000 kg*m/s

77. Two blocks, with masses m1 = 400 g and m2 = 600 g, are connected by a string and lie on a frictionless tabletop. A force F = 3.5 N is applied to block m2. Find the acceleration of each object.

Answers

Answer:

See the answers below. And the free body diagrams attached.

Explanation:

To solve this problem, we must build a free body diagram, where we show the forces acting on a body, first for the m2 body, where the force of 3.5 [N] acts to the right. In such a way that a reaction force is presented in the opposite direction due to the string tied between both bodies, we will call this force T1.

Now using Newton's second law, which is defined as the sum of forces equal to the product of mass by acceleration, we can determine an equation as a function of T1.

∑F = m*a

[tex]3.5 -T_{1}=0.6*a_{2}[/tex]

We have an equation with two unknowns, in such a way we must perform a second free body diagram for the body with mass m1, to acquire the additional equation.

∑F =m₁*a₁

[tex]T_{1}=0.4*a_{1}[/tex]

By kinematics we know that if the string tied to Body 2 moves a distance, the part of the string at the end tied to body 1 will move the same distance. This same analysis is valid for velocities and accelerations.

This is the accelerations a1 and a2 are equal. Now equalizing both equations.

[tex]3.5-0.4*a_{1}=0.6*a_{2}\\but\\a_{1}=a_{2}\\3.5-0.4*a_{1}=0.6*a_{1}\\a_{1}=3.5[m/s^{2} ][/tex]

The acceleration of each block connected by the given string is 3.5 m/s².

The given parameters;

mass of the first block, m1 = 400 g = 0.4 kgmass of the second block, m2 = 600 g = 0.6 kgapplied force, F = 3.5 N

The net force on the blocks is calculated as follows;

[tex]\Sigma F = ma\\\\F - T = m_2a\\\\F - m_1(a -g)= m_2a\\\\g = 0 \ , \ in \ horizontal \ direction\\\\F - m_1a = m_2 a\\\\F = m_2 a + m_1 a\\\\F = a(m_1 + m_2)\\\\a = \frac{F}{m_1 + m_2} \\\\a = \frac{3.5 }{0.4 + 0.6} \\\\a = 3.5 \ m/s^2[/tex]

Thus, the acceleration of each block connected by the given string is 3.5 m/s².

Learn more here:https://brainly.com/question/20357188

Which observation supports a model of the nature of light in which light acts as a wave?
A. Constructive interference
B. Temperature change
C. Blackbody radiation
D. Photoelectric effect​

Answers

Answer:

Explanation:

Hope this helps!

Answer:

a. constructive interference

Explanation:

100% correct

Which type of wave forms at the boundary between air and water when you
drop a rock into a pond?
A. Electromagnetic
B. Surface
C. Longitudinal
D. Transverse

Answers

Answer:
D. Transverse
Explanation:
If you throw a rock into a pond ripples spread out from where it went in.These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations are at 90 degrees to the direction of travel .

please please help

The law of conservation of charge states that the total charge remains the same after a transfer of electrons.
true or false

Answers

Answer:

true

Explanation:

The law of conservation of charge states that whenever electrons are transferred between objects, the total charge remains the same.

The moon has a mass of 7.34 . 102 kg and a radius of 1.74 . 106 meters. If you have a mass of 66 kg,
how strong is the force between you and the moon?​

Answers

Answer:

[tex]F=1.06\times 10^{-18}\ N[/tex]

Explanation:

Given that,

Mass of the Moon, [tex]M=7.34\times 10^2\ kg[/tex]

Mass of the person, m = 66 kg

The radius of Moon, [tex]r=1.74\times 10^6\ m[/tex]

We need to find the force between the person and the Moon. The formula for the gravitational force is given by :

[tex]F=G\dfrac{Mm}{r^2}\\\\F=6.67\times 10^{-11}\times \dfrac{7.34\times 10^2\times 66}{(1.74\times 10^6)^2}\\\\=1.06\times 10^{-18}\ N[/tex]

So, the required force is [tex]1.06\times 10^{-18}\ N[/tex].

Which type of matter is likely to absorb the most sound waves
A:hot air
B:metal door
C:foam wall:
D:Loudspeaker

Answers

Answer:

im postive its D) loudspeaker

Answer:

foam wall

Explanation:

ap3x

Showing results for a 4 olm and 8 ohm resistor are connected in series. The current through the 4 olm resistor is 2 amps. What is the current through the 8 olm resister?

Plzzzz help 20 points

Answers

Answer:

Let R1= resistance of 4ohms

R2= resistance of 8ohms

Equivalent resistance R will be

R=R1 + R2

=> 4+8=12ohms

The current through the two resistors will be the same since they are connected in series. Notwithstanding, the voltage will drop to appreciate the change.

Explanation:

The value of current from the 8-ohm resistor is the same as in the 4-ohm resistor which is equal to the 2 Amp.

What is resistance?

Resistance is a type of opposition force due to which the flow of current is reduced in the material or wire. Resistance is the enemy of the flow of current.

When two resistors are connected to the series in that condition the value of current is the same in both the resistors.

While the value of resistance is different in both the different.

Hence the value of current from the 8-ohm resistor is the same as in the 4-ohm resistor which is equal to the 2 Amp.

To learn more about the resistance refer to the link;

https://brainly.com/question/20708652

Other Questions
Historically, mining and purifying uranium hasn't been a very clean process. Even transporting nuclear fuel to and from plants poses a contamination risk. And once the fuel is spent, you can't just throw it in the city dump. It's still radioactive and potentially deadly. On average, a nuclear power plant annually generates 20 metric tons of used nuclear fuel, classified as high-level radioactive waste. When you take into account every nuclear plant on Earth, the combined total climbs to roughly 2,000 metric tons a year [source: NEI]. All of this waste emits radiation and heat, meaning that it will eventually corrode any container that holds it. Choose the best concluding statement for this paragraph. A) Nuclear power is a good thing, but no one can say how much of a good thing B) The relative value of employing nuclear power depends largely on the circumstances. C) Nuclear power involves many environmental dangers, which must be taken into consideration. D) Nuclear power should be forbidden outright; whatever benefits it brings are far outweighed by the costs. 2 3/8 x 3 3/4 divided by 2 2/3 The importance of the shrine that the author visits A bus traveled at a constant speed of 80 km/h. How long did it take the bus to travel 40 km? A basketball player made 44 out of 100 attempted free throws. What percent of free throws was made? An article tells the life story of an inventor. It begins with his birth then discusses his years at school. After exploring his great inventions, the article ends with his death.Which choice best describes how the author organized information? Cause and effect Chronological order Fact by fact Problem-solution can someone give me an example of transformation of electrical to mechanical energy ill mark u as brain list HELP PLZ What connections can we make between finding the slope of a line connecting two points and the distance between those same two points? 1. 42+14x2. 3(2x + 9) what is the value of y in the solution to the system of equations 5x-y=25 and x+4y=-10 Any body got common lit answers 3 Drag the tiles to the boxes to form correct pairs. Match the expressions with the property used to generate 5y + 2y+ 6+2. Distributive Property 6y - y + 2y + 10 - 4 + 2 5y + 2(y + 3) + 2 combining like terms 5y + 2 + 6 + 2y Commutative Property cared How can I solve .6 x .5 Which is a like radical to 3 sqrt 54 and 3 sqrt 128 when the expression are simplified? Which rule applies to the translation of the RED trapezoid to the BLUE trapezoid?)(c.y) - (x* 2, y- 3)B)(x. y) - (x+ 4, y- 5)(x, y) - (x + 2, y - 5)D)(.Y) - (x- 2, y - 5) what color is the darkest.A. RedB. BlueC. purpleD. Black Read this excerpt from from Robinson Crusoe:Then I took my turn, and embraced him as my deliverer,and we rejoiced together. I told him I looked upon him as aman sent from Heaven to deliver me, and that the wholetransaction seemed to be a chain of wonders (243).Based on the wording in this excerpt, which of the following is Crusoe mostlikely describing?O A. A mutineerOB. A cannibalOC. The captainOD. Friday the measure of G is 82. What is the measure of its compliment? facts on wourld war 2 TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA