Three apples (x) plus two
oranges (y) costs $16.
Five apples plus two
oranges costs $24. How
much do each apples and
oranges cost?

Answers

Answer 1

Answer:

Each apple cost $4

Each orange costs $2

Step-by-step explanation:

5x4=20

2x2=4

20+4=$24


Related Questions

The weight of one ticket is approximately 1.67 × 10-4 g. Write the numerical value without scientific notation.

Answers

Answer:

0.000167 g

Step-by-step explanation:

[tex]1.67 \times {10}^{ - 4} \: g\\ \\ = 0.000167 \: g[/tex]

The two figures shown are congruent. Which statement is true?

Answers

Answer:reflection image of the other

Source:trust me bro

The last choice because it’s like you drawing it on a peace of paper and then folding the paper in half and then rubbing it on the other said of the paper

Could I get help with this one?

Answers

Answer:

x3

Step-by-step explanation:

Factor the following expression using the GCF.

8dr – 24r

r(8d – 24)
4r(2d – 6)
8(dr – 3r)
8r(d – 3)

Answers

Answer:

the answer to your question is 8r(d-3)

hope this helps :-)

what is the y intercept y=-4x-5

Answers

Answer:

The y-intercept y = 4x - 5 is (0,-5).

Step-by-step explanation:

hope this helps

have a great day

plz consider marking brainliest

What’s the common factor for 72 and 84

Answers

Answer:

Step-by-step explanation:

This is the general method for doing this problem. First factor these numbers into primes.

72: 2 * 2 * 2 * 3 * 3

84: 2*2 * 3 * 7

Now each number has at least two 2s

Each number has at least one          3

The highest common factor is 2 * 2 * 3 = 12

horizontal distance of 10 feet and rice 3 feet. Find the length of the ramp.

Answers

Answer:

Step-by-step explanation:

Tye length of the ramp can be gotten using Pythagoras theorem.

Horizontal distance = 10ft.

Vertical distance = 3ft

Length of the ramp² = 10²+3²

Length of the ramp² = 100+9

Length of the ramp² = 109

L² = 109

L =√109

L = 10.44ft

Hence the length of the ramp is 10.4ft to the nearest tenth

Pls help!!! What is this expression in simplified form?

Answers

Answer:

My guess would be D

Step-by-step explanation:

The temperature in Minsk was recorded over a period of four hours. The
equation
y = -5x + 54
describes the temperature over this time, where y is the temperature in
degrees Fahrenheit (°F) and x is the number of hours since measurements
started. Which of the following statements correctly describes the
temperature?
A. It was -5°F after four hours, and it is rising by 54 degrees per
hour.
B. It was 54°F when the temperature was first measured, and it is
dropping by 5 degrees per hour.
c. It was -5°F when the temperature was first measured, and it is
rising by 54 degrees per hour.
O D. It was 54°F after four hours, and it is dropping by 5 degrees per
hour

Answers

Answer:

D.) it was 54 degrees Fahrenheit when the temperature was first measured, and it is dropping by 5 degrees per hour

Step-by-step explanation:

I took the quiz

Answer:

D

Step-by-step explanation:

I took the test

1)
An ice machine uses 3 gallons of water every 9 hours. How many gallons of water does it use each hour? How many
hours does it take to use one gallon?
A)
B)
gallon per hour, 1 hour
gallon per hour, 3 hours
3 gallons per hour, 5 hour
gallon per hour,
1 hour
D

Answers

Answer:

B

Step-by-step explanation:An ice machine uses 3 gallons of water every 9 hours. How many gallons of water does it use each hour? How many

hours does it take to use one gallon?

A)

b)

gallon per hour, 1 hour

gallon per hour, 3 hours

3 gallons per hour, 5 hour

gallon per hour,

1 hour

D

Population of California in the year 1995 was 32 million. If the population grows at a rate of 2%, what will the population be in 2025?

Answers

Answer:

hi 51.2 is the answer

Step-by-step explanation:have a good day.

The population of California in the year 2025 is approximately 57.96 million.

To calculate the population of California in 2025, we need to use the population growth formula:

Population in the future = Population in the present * [tex](1 + Growth rate)^{Number of years}[/tex]

Given:

Population in 1995 = 32 million

Growth rate = 2% = 0.02 (in decimal form)

Number of years = 2025 - 1995 = 30 years

Now, let's calculate the population in 2025:

Population in 2025 = 32 million * (1 + 0.02)³⁰

Population in 2025 ≈ 32 million * (1.02)³⁰

Population in 2025 ≈ 32 million * 1.8114

Population in 2025 ≈ 57.9648 million

Therefore, the population of California in the year 2025 is approximately 57.96 million.

To know more about population:

https://brainly.com/question/15889243


#SPJ2

Order the set of integers from least to greatest 5, -3, -12, 9

Answers

Answer:

-12, -3, 5, 9

Step-by-step explanation:

ok. So the numbers are 5, -3, -12, and 9.

In these numbers, there are 2 negatives. They are -12 and -3.

In negatives, the bigger the number is, the number is smaller.

So we first put

-12, -3 as our 2 first. Then the other ones are 5 and 9.

and you obviously know that 5 is less than 9. try it out. 9-5 =4 which is positive

So then you put 5, 9

And our full answer is

-12, -3, 5, 9

-12, -3, 5, 9 is the correct order from least to greatest.

9x - y power two - 20 ≥ 0 i need every passage​

Answers

Answer: photo

Step-by-step explanation:

I am not sure but hope it helps

Use this scenario to answer questions 3-4: Peter was a waiter that was paid at a rate of $8 per hour plus tips. He earned a total of $200 including $54 in tips.


Given the scenario above, write an equation to represent the scenario. Let h = the number of hours
Free brainliest included! :)

Answers

8h+54=200 because if the waiter makes 8 dollars an hour plus 54 dollars in tips, that’s the equation.

Identify the slope from the table

NEED HELP PLEASE thank you sb

Answers

The slope is -4 or c on the table

Answer:

-4

Step-by-step explanation:

‘X’ adds by one while ‘y’ adds by -4

evaluate 8 times (2-3) to the 2 power divided by 4

Answers

Answer:

Step-by-step explanation

8 x (2 - 3)^2 /4
8 x (-1)^2 /4
8 x 2 /4
16/4
4

The answer is 4

-1/4 ÷ -3/8
Please Hurry

Answers

Answer:

2 /3 (decimal form ≅ 0.6666667 )

Step-by-step explanation:

Unary minus: -1 /4

= -1 /4

Unary minus: -3 /8

= -3 /8

Divide: the result of step No. 1 : the result of step No. 2 = -1 /4 : (-3 /8 ) =

-1 /4  x -8 /3  = -1 (-8)  divided by 4(3)  = 8 /12  = 4(2 ) divided by 4(3)  = 2 /3

I need this for sis!:D I will give thanks!

Answers

I do believe that it is the second one I’m not 100% sure but I’m pretty sure it is

HELP ASAP LAST QUESTION

Answers

Answer:

-9.63

Step-by-step explanation:

-√92.75=

-9.63

-9.63 Hope it helps :D

Mrs. Healy has two dogs rocky and chino. rocky eats 2 dog treats each day and Chino eats 5 each day. How many treats do the dogs eat in 4 days?

Answers

Answer:

28 treats

Step-by-step explanation:

2x4

5x4

20+8=28

Answer:

the answer is 28 treats in 4 days for both dogs

Step-by-step explanation:

2*4=8+    5*4=20= all together 28 treats for 2 dogs

hope this helped

Alaina is making a birdseed mix with 2 1/3 lb sunflower seeds, 5/6 lb cracked corn, and 1/6 lb peanuts. How much cracked corn does Alaina need to make 5 lb of birdseed mix? Show your work.

Answers

Answer:1.25

Step-by-step explanation:

If you add everything it makes 3 and 1/3 pounds you want 5

If you divide 5 by 3 and 1/3 it's 1.5

Then you just need to multiply 5/6 by 1.5

For making 5 lb birdseed mix  1 ¹/₄ lb cracked corn will be used.

What is proportion ?

A proportion is an equation based on the equality of two ratios.

Here it is given that :

Alaina is making a birdseed mix with 2 1/3 lb sunflower seeds, 5/6 lb cracked corn, and 1/6 lb peanuts.

adding everything to make birdseed mix = 2 1/3 + 5/6 + 1/6 =10/3 lb

Now,

for making 10/3 lb birdseed mix = 5/6 lb cracked corn is used

in other words :

for making 1 lb birdseed mix = (5/6) x (3/10) lb cracked corn is used

that is , for making 5 lb birdseed mix = (5/6) x (3/10) x 5 lb cracked corn will be used.

 = 15/12 = 5/4 = 1 ¹/₄ lb  cracked corn will be used.

Therefore, for making 5 lb birdseed mix 1 ¹/₄ lb cracked corn will be used.

Read more about ratio at:

https://brainly.com/question/17869111

#SPJ2

PLEASE HELP!!!!!!!!!!!!!!!

Answers

Nice I like the black pic :D

Answer:

Blue

blue with a hint of orange

-15= x/-0.5 8= what does x equal

Answers

8*0.5*x=-15
x = -15/4

What number does E represent?

Answers

E represents 1/2, I needed more letters

Sam earns $54 275 in a year.
He pays no income tax on the first $8200.
He pays 18% income tax on everything he earns over $8200.
a Work out how much income tax he pays.
b Work out what percentage of his income he pays in tax.
If the income tax rate is increased to 21%, how much more tax will Sam pay?​

Answers

Answer:

he would pay $8,293.5 in income tax.

b:

Step-by-step explanation: he pays  15.280515891294% of his pay in tax. if the income rate was increased to 21% then he would pay 9,675.75‬ in taxes.  Which is 1,382.25 more than 18% tax.

PRE-CALC
khalid invests $500 in an account that earns 1.5% interest per year, compounded annually. Which of the following is formed by the amount in his account from year to year?

an arithmetic series
an arithmetic sequence
a geometric series
a geometric sequence

Answers

D.  Geometric Sequence

For your question: "Khalid invests $500 in an account that earns 1.5% interest per year, compounded annually. Which of the following is

formed by the amount in his account from year to year?"

The geometric sequence is formed.

Answer:

d

Step-by-step explanation:

Match each equation to the situation it represents
1st one says Leilah
2nd one says Stetson​

Answers

Answer:

leiah has not yet studied......          =    2400 - 40x = 600

stetson rests studios spaces......   =    40x - 600 = 2400

a kit contains....                               =.    (600 + 40) x = 2400

Step-by-step explanation:

that might make it a bit easier

What is the constant rate???

Answers

Answer:

The constant rate is 4

Step-by-step explanation:

40 ÷ 10 = 4

80 ÷ 20 = 4

120 ÷ 30 = 4

160 ÷ 40 = 4

They all equal 4 so that is the constant rate.

Brainliest???

Use the elimination method to solve the system of equations. Choose the correct ordered pair.
2x-5y=2
3x+2y=-16

Answers

Answer: (-4, -2)

Step-by-step explanation:

just took the test and got this right! :-)

Three friends are selling items at an arts and crafts fair. Kim makes $45.75 selling jewelry. Mark makes 100 times as much as Kim selling his custom picture frames. Carlos makes one tenth of the money Mark makes selling paintings. How much money does each friend make?

Answers

Answer:

mark is making $4,575, Carlos is makeing 457.50

Other Questions
what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT The corect phase sequence shownGas, Liguid, SolidLqud, Gas, SolidSold, Liguid, GasGas, Solid, Liquidabove i Which word comes from the Greek root meaning life A-boulevard B-BiologyC-bombardD-barometer Can Someone help me please Requiring children to be vaccinated before entering school is an example of what power? need help for civics What is the mass of 1.00 mol of oxygen (O2)? Cual Es el mejor programa esta ano A car is 180 inches long. A truck is 75% longer than the car. How long is the truck? How are ionic compounds named? Giving everything. Plzzz help. Which scientific term could be used in place of the word germ?a. bacteriologyb. pathogenc. hostd. replicate Form a correct sentence by unscrambling the following jumbled words:El pueblo el en reino.El en el pueblo reino.El pueblo el reino en.El pueblo en el reino.Pueblo el en reino el. What would be the mass, in grams, of 1.505 x 10^23 molecules of carbon disulfide (CS2)? What is meant by Kant's subjectivism Which of the following outcomes is most consistent with the pluralist model of democracy?a) Protests initiated by the group lead to a public backlash against the new law.b) The Supreme Court declares the new campaign finance law unconstitutional.c) Congress passes a law that addresses some of the groups concerns but omits others.d) Federal bureaucrats delay implementation of the new law after it has passed Congress. The narrator of a storyis always the same person as the author.is always part of the narrative.determines the story's characters and events.provides information about characters and events In addition to granting Solomon's request, God gave him what he did not ask for, which was what?Lebanonmany wiveswisdomriches