Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

Answer 1
I don’t feel like answering all that but....
C=G G=C T=A A=U
Answer 2
C=G A=T dont know the rest have a gcodocododd dday

Related Questions

shape of the smooth muscle cell​

Answers

Answer:

They are flat layers

Explanation:

However, smooth muscle fibers do not form thick ropes like skeletal muscles. Instead, they come together in smooth, usually flat layers.

PLEASE HELP ME WITH THIS!
Considering ethical questions is part of a marine scientist’s job. Part of being ethical is doing your homework and exploring all sides of an issue. Choose a current ethical issue in marine science, such as the use of genetically modified organisms (GMOs), conditions in fish farms, or another topic your instructor approves. Find two perspectives supporting one side of the ethical issue and two supporting the other. Be sure to use reliable sources, such as university web sites or newspaper/magazine articles. Create an outline with at least five points for each side. Then write a brief paragraph explaining what you believe an ethical choice around this issue is. Remember, ethical problems are difficult because both sides have valid points. Be sure to consider and discuss at least one point you think is valid from the side that you disagree with in your conclusion as you explain why your choice is the ethical one. Also, include a list of sources that you used. Two is the minimum for each point of view.

Answers

lo siento cariño, esto está fuera de mi alcance, los biloogistas marinos son geniales y me encanta ayudar, pero no puedo, lo siento mucho. como si realmente estuviera jodiendo como si apesta jaja quiero ayudarte pero no puedo

One current ethical issue in marine science is the use of genetically modified organisms (GMOs) in aquaculture.

What are genetically modified organisms?

Genetically modified organisms (GMOs) are living organisms whose genetic material has been artificially altered in a laboratory using genetic engineering techniques.Here are two perspectives supporting each side of the issue:

Perspective 1: According to a report by the World Health Organization (WHO), GMOs have the potential to reduce the environmental impact of aquaculture by decreasing the need for wild fish as feed, reducing the use of antibiotics, and decreasing the risk of disease outbreaks.

Perspective 2: Opponents of GMOs in aquaculture argue that they pose a significant risk to wild fish populations and the environment. According to the Ocean Conservancy, GMO fish can escape from fish farms and breed with wild fish, potentially altering the genetic makeup of natural populations and harming biodiversity.

Therefore, use of GMO's is profitable as well as hazardous for the environment.

Learn more about genetically modified organisms, here:

https://brainly.com/question/30094586

#SPJ3

If you have a viral infection, why should you cover your mouth when you sneeze? * To prevent other people from breathing in the viruses you expel To prevent viruses from infecting cells in your nose and mouth To keep as many viruses as possible in your own body To get all of the cold viruses out of your body and onto your skin.

Answers

Answer:

To prevent other people from breathing in the viruses you expel

Explanation:

CORRECT

What is needed for the rock cycle to continue?

Answers

Answer:

The rock cycle is a concept used to explain how the three basic rock types are related and how Earth processes, over geologic time, change a rock from one type into another. Plate tectonic activity, along with weathering and erosional processes, are responsible for the continued recycling of rocks.

1. Are the following cell parts located in a plant cell, animal cell or both?
-Nucleus
-Cell Wall
-Mitochondria
-Cytoplasm
-Chloroplasts
-Vacuole
-Cell Membrane

Answers

Answer:

1. both

2. Plant cell

3. Plant cell

4. both

5. Plant cell

6. Both

7. Both

Explanation:

Plant cells have a cell wall and a cell membrane, unlike animal cells that only have a cell membrane.

Both have a cytoplasm, vacuole, mitochondria, and a nucleus.

Hope this is correct. Good luck with your studies.

Both plant cell and animal cell have a nucleus, mitochondria, cytoplasm, and cell membrane. Only a plant cell have cell wall, chloroplast and vacuole.

Difference between Plant cell and Animal Cell?

Plant cells are the unit of plants. These cells are present in all green and non-green cells in a plant. However, an animal cell is the fundamental unit of an animal. Different types of animal cells make up an organism.

Plant cell contain an outermost covering called the cell wall. It protects them from shock and provides mechanical strength to the cell. It is absent in the animal cell.

Chloroplast is also present in the plant cells whereas it is absent in the animal cells. It is a double-membranous structure. A chloroplast is responsible for the process of photosynthesis as it contains chlorophyll pigment. A vacuole is also present in the plant cell and absent in an animal cell. The vacuole is responsible for the storage of reserved food materials in the form of complex sugars.

Learn more about Plant cell here:

https://brainly.com/question/1493437

#SPJ2

What are the names given to the process by which carbon molecules are broken down to make carbon dioxide and release a great amount of energy?

Answers

Answer:

Explanation:

Cellular respiration  -

Cellular respiration is the aerobic process by which living cells break down glucose molecules, release energy, and form molecules of ATP. Overall, this three-stage process involves glucose and oxygen reacting to form carbon dioxide and water.

Answer:

The tricarboxylic acid cycle

The Kelvin cycle

Explanation:

Question 4
1 points)
A scientist warms a chemical to 385 K, and the chemical begins to boil. How much higher is this boiling point of the chemical
than the boiling point of water?

Answers

12K is the boiling point of the chemical .

The boiling point of any liquid changes to the applied pressure the normal boiling point is the temperature at which the vapor pressure is equal to the standard sea-level atmospheric pressure .At sea level, water boils at 100° C (212° F).The boiling point of a liquid is the temperature at which its vapor pressure is equivalent to the pressure of the gas above it.

Boiling point is used to identify and classify a given compound. A liquid boils when its vapour pressure is equal to the atmospheric pressure. Vapour pressure is also defined  by the kinetic energy of a molecule. Kinetic energy is dependent on the temperature, mass and velocity of a molecule.

To learn more about vapour pressure , here

brainly.com/question/25699778

#SPJ1

Which of the following is NOT related to lipids (does not belong)?

A)fatty acids

B)energy storage

C)sugars

D)fats, oils, waxes

Answers

option c is the answer of your question

question



A student poured a solution of bromothymol blue indicator into three test tubes. Then he placed an aquatic plant in two of the test tubes, as shown below. He placed a stopper on each test tube and placed them all in the dark for 24 hours. Bromothymol blue turns from blue to yellow in the presence of CO2


Predict what will happen to the test tubes in Figure 9–9 after 24 hours in the dark.

Answers

In the dark the aquatic plant won't do photosynthesis. Instead it will do cellular respiration in which it will produce CO2. Therefore after 24 hours of letting the plant in the dark introducing Bromothymol in the solution will cause it to turn yellow.

The first hoops were actually peach baskets and the first backboards were made of plywood. The given statement is true.

Why mental health and emotional health is an important role in ones life?

So you'll be getting out of the house and hanging out with them rather than being alone with no one to talk or turn to. Which now leads us to mental health our emotions will be average rather than feeling utterly alone and if you ever feel that way your good friend will help you and talk you through it.

The health triangle consists of Physical, Social, Mental Health. Physical health deals with overall working for organs and skeleton structure together. It includes food intake, sleep and exercise and Mental health deals with how peaceful and positive mind human being have. It includes stress management and mental diseases. Social health deals with how we interact with people and how often we interact. It includes family and friends relationships.

Therefore, The first hoops were actually peach baskets and the first backboards were made of plywood. The given statement is true.

Learn more about health triangle on:

https://brainly.com/question/8411886

#SPJ2

If there is 37% of cytosine in a molecule of double-stranded DNA, what percentage of guanine is present?
A.) 63%
B.) 40%
C.) 37%
D.) 60%

Answers

B would be the answer to your question

Answer: B

Explanation:

If you REALLY think about it , you will see that it is 40%

What is an advantage to SMRs?
Select all that apply.


less atmospheric emissions


use fusion instead of fission

reduced cost


reduced construction time

Answers

Answer:

PLEASE MARK ME THE BRANIEST THANK YOU :)

Explanation:

The next decades are crucially important to putting the world on a path of reduced greenhouse gas emissions.

By the end of the century, demand for energy will have tripled under the combined pressure of population growth, increased urbanization and expanding access to electricity in developing countries. The fossil fuels that shaped 19th and 20th century civilization can only be relied on at the cost of greenhouse gases and pollution.

A new large-scale, sustainable and carbon-free form of energy is urgently needed. The following advantages make fusion worth pursuing.

Abundant energy: Fusing atoms together in a controlled way releases nearly four million times more energy than a chemical reaction such as the burning of coal, oil or gas and four times as much as nuclear fission reactions (at equal mass). Fusion has the potential to provide the kind of baseload energy needed to provide electricity to our cities and our industries.

Sustainability: Fusion fuels are widely available and nearly inexhaustible. Deuterium can be distilled from all forms of water, while tritium will be produced during the fusion reaction as fusion neutrons interact with lithium. (Terrestrial reserves of lithium would permit the operation of fusion power plants for more than 1,000 years, while sea-based reserves of lithium would fulfil needs for millions of years.)

No CO₂: Fusion doesn't emit harmful toxins like carbon dioxide or other greenhouse gases into the atmosphere. Its major by-product is helium: an inert, non-toxic gas.

No long-lived radioactive waste: Nuclear fusion reactors produce no high activity, long-lived nuclear waste. The activation of components in a fusion reactor is low enough for the materials to be recycled or reused within 100 years.

Limited risk of proliferation: Fusion doesn't employ fissile materials like uranium and plutonium. (Radioactive tritium is neither a fissile nor a fissionable material.) There are no enriched materials in a fusion reactor like ITER that could be exploited to make nuclear weapons.

I HOPE YOU LIKE MY ANSWER THANK YOU:)

What is a photosytem

Answers

Answer:

Below

Explanation:

The light reaction of photosynthesis. ... High-energy electrons, which are released as photosystem I absorbs light energy, are used to drive the synthesis of nicotine adenine dinucleotide phosphate (NADPH). Photosystem I obtains replacement electrons from the electron transport chain.

Which of the following is NOT an example of a plant adaptation towards success in their habitat.

Question 1 options:

A.Colored flowers attract pollinators to scatter their seeds.


B.Plants grow thorns to repel grazers to prevent damage.


C.Plants grow towards light as they compete fro resources.


D.Plants take in water for photosynthesis.

Answers

D.Plants take in water for photosynthesis.

the rest are influenced by their habitat

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

What carries digested food to the cells of an animal?
A. plasma
B. enzymes
C. red blood cells
D. white blood cells

Answers

Answer:

B. Enzymes

Explanation:

Animals feed by secreting enzymes through the cell membrane onto the food. The enzymes break the food into molecules small enough to be taken pass through the cell membrane into the cell.

pick two structures from an animal cell and explain how they work together and how their functions are vital in keeping the cell alive. the options are cytoplasm, smooth er, nucleolus, nucleus, mitochondria, lysosome, and cell membrane.

Answers

Answer:

the cell membrane is the semi-permeable protective cover that keeps the cell held together. the cytoplasm is semi-fluid within the cell membrane that keeps the cell in shape.

Explanation:

hello I need help!!! did I get this right ​

Answers

Answer:

Yeah it is correct.

Explanation:

Things enter the cell through the cell membrane through either active or passive transport which can tell you that the cell membrane controls what goes in and out.

I believe so. I looked it up and it matched everything I found

Which statement is the best example of an object and motion that would make it hard for people to accept Newton’s first law?


A. A rolling ball eventually slows down and comes to a stop.

B. A box does not move when pushed equally from opposite sides.

C. The heavier the load in a cart, the harder the cart is to turn.

D. A wago

Answers

Answer:

a

Explanation:

object in motion will stay in motion until it is acted upon

Answer:

A

Explanation:

7 A student who was training for a cross country race jogged for 2.0 hours and covered a
distance of 14.0 kilometers. What was the average speed of the student?
A
28.0 km/hr
B
7.0 km/hr
С
12.0 km/hr
D
0.14 km/hr

Answers

Answer:

7.0 km/hr

Explanation:

A student who was training for a cross country race jogged for 2.0 hours and covered a distance of 14.0 kilometers. The average speed is 7.0 km/hr. Hence option B is correct.

What is training?

Training is defined as the process of educating or training your staff on a certain task in order to increase their performance or expertise. There are three main goals of training from the perspective of the individual employee: Increase the person's awareness level. Boost a person's proficiency in one or more of their areas of specialization. increase the drive for someone to do their work successfully.

Average speed is defined as the entire distance that an object has gone in a given amount of time.

It can be expressed as

Speed = Distance / time

Speed =  14.0 km / 2.0 h

Speed = 7.0 km / hr.

Thus, a student who was training for a cross country race jogged for 2.0 hours and covered a distance of 14.0 kilometers. The average speed is 7.0 km/hr. Hence option B is correct.

To learn more about training, refer to the link below:

https://brainly.com/question/11915398

#SPJ2

Which of the following is not a technological way of improving air quality?
a.
using electrostatic precipitators
b.
installing solar panels
c.
composting
d.
building wind turbines

Answers

Answer:

c.

composting

Explanation:

Composting is not a technological way of improving air quality (Option C).

What is air quality?

Air quality refers to the absence of pollutant substances (e.g. monoxide carbon) in the air.

Air quality is fundamental for maintaining overall health and increasing the quality of life.

Air quality can be measured by using different devices or indicators (for example, by measuring the amount of carbon monoxide and nitrogen oxides).

In conclusion, composting is not a technological way of improving air quality (Option C).

Learn more about air quality here:

https://brainly.com/question/1211889

What is the purpose of DNA? *
A. manufactures proteins
B. reduces activation energy
C. stores hereditary information
D. to aid in facilitated diffusion

Answers

Answer:

c is your right answer

Explanation:

The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce. Essentially, it is the biological instruction manual found in each of your cells.

which cell stucture is responsible for the passage of material into and out the cell

Answers

Hrjdusheuejebeuebwie

The list describes examples of several ways organisms obtain energy.

Organism A eats other living things for food.

Organism B gets food from parts of decomposing matter.

Organism C makes its own food.

Organism D absorbs food from what it lives in or on.

Select the organism that would be classified as a member of the plant kingdom.

A
Organism D
В.
Organism B
Organism A
D.
Organism C

Answers

organism c. plants are autotrophs which means they make there own food

Organism C makes its own food is examples of several ways organisms obtain energy.

What is Energy?

Energy is referred to by scientists as the capacity for work. People have figured out how to transform energy from one form to another and then use it to accomplish tasks, making modern civilization possible.

Walking and bicycling, driving cars on roads and boats through water, cooking meals on stoves, making ice in freezers, lighting our homes and workplaces, producing goods, and sending astronauts into space all require the usage of energy.

Energy is capable of changing its forms. For instance, a person's body stores chemical energy from the food they consume until they may use it as kinetic energy when working or playing.

Therefore, Organism C makes its own food is examples of several ways organisms obtain energy.

To learn more about Energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2


How is a phospholipid structurally related to a triglyceride?
Help

Answers

The phospholipid is similar to the triglyceride in that it contains fatty acid tails attached to a glycerol backbone. However, the phospholipid contains a organic phosphate zwiterion instead of a third fatty acid tail.

answers plz???????!!!!!!!!

Answers

Answer:

first blank is two, second blank is four

Explanation:

Mitosis results in two genetically identical cells.

Meiosis results in four sex cells.

olha nao dissseste a perguntaaa

What is the niche of the shark whales?

Answers

Answer:

The whale sharks niche in the environment is essentially population control. The whale shark spends all day eating and without it the populations of krill and plankton would increase by a large amount.

Explanation:

Whale sharks have a broad distribution in tropical and warm temperate seas, usually between latitudes 30°N and 35°S. They are known to inhabit both deep and shallow coastal waters and the lagoons of coral atolls and reefs. Australia is one of the most reliable locations to find whale sharks. It is very difficult to conduct research on the shark's role in the ecosystem so scientists aren't sure what would happen if sharks became extinct. ... If the whale shark becomes extinct, there might be an increase in plankton. However, plankton are also eaten by several species of whale. Whale sharks are one of the most amazing animals in the world — and while they may be sharks, they're also one of the most gentle fish in the sea. In fact, whale sharks are so gentle, they're completely safe to swim around. Our Whale Shark Encounter tour gives you the opportunity to do just that.

That's one scary shoork-

During facilitated diffusion - it is still passive but needs help of proteins to help pass.


false


true

Answers

Answer:

True

i think

Explanation:

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

4. Which is an example of a fungus?
O blue-green algae
slime mold
O bread mold
O brown algae

Answers

Answer:

Bread mold is an example of a fungus.

hope it helps!

Fill in the blank:

Word Bank:

Cyclins, Inactivation, Skin, Cancer, Chromatids, Nerve

In multicellular organisms, cell growth and division is very controlled. Some cells like muscle and _______ cells stop dividing after maturity. Other cells like ______ and blood cells grow and divide rapidly through life. _______ are proteins that regulate the timing of the cell cycle, "telling" the cell when to divide. If cells stop responding to regulation, uncontrolled cell growth can lead to ______.

Answers

Nerve, Skin, Cyclins, Cancer

The growth and development of an organism are dependent on the control and coordinated activities of the cells, tissues, and organs.

The correct blanks for the given paragraph are:

In multicellular organisms, cell growth and division are very controlled. Some cells like muscle and nerve cells stop dividing after maturity. Other cells like Skin and blood cells grow and divide rapidly through life. Cyclins are proteins that regulate the timing of the cell cycle, "telling" the cell when to divide. If cells stop responding to regulation, uncontrolled cell growth can lead to cancer.

The statements can be explained as:

The muscle and nerve cells stop dividing after maturity. The nerve cells lack centrioles, which play a crucial role in the division of cells. Thus, the nerve and muscle cells do not divide.

The skin and blood cells divide continuously and throughout life. The cells when are damaged or dead, these cells replace them.

Cyclins are the proteins, which regulate and activate the cell cycle by binding with the cyclin-dependent kinases.

Cancer is repetitive and uncontrolled cell growth. It can be caused due to failure of regulation of cell cycle or any carcinogen exposure.

Therefore, the correct answers are nerve, skin, cyclin, and cancer.

To know more about cell division, refer to the following link:

https://brainly.com/question/19644932

Other Questions
Hellllp please asap ASAP help me with this question Can someone pls help me!!! What was the main reason that most northerners were opposed to the Fugitive Slave Act? A.They resented being forced to help slave owners.B. They felt it would encourage slaves to rebel.C. They felt it gave the government too much power.D. They resented being forced to help abolitionists. A customer at a store paid $42 for 4 pairs of pants and 3 shirts. At the same store, a second customer paid $2 more for 1 pair of pants and 7 shirts. The price of each pair of pants is the same, and the price of each shirt is the same. Which system of equations can be used to find the price in dollars of each pair of pants, x, and each shirt, y? Find the sale price of the item. Round to the nearest cent if necessary. Original price: $75.00 Markdown: 34% The sale price is, in dollars, is $ Can someone please help with writing this out as equation? The student council has decided to sell t-shirts with a school logo to promote school spirit. Amanda investigated 1 company that would charge $75 to make the printing screen for the shirts, and then $5.50 per shirt. Adam checked out a 2nd company that would charge a straight $7 per shirt. Which company's option would respresent a proprtional relationship? You should support your answer with an equation, a table of values, or a graph. Write one paragraph explaining what you have learned so far about Kinetic and Potential Energy. (will give brainliest) HELPPPP look at image Use the adjective ________ to describe something or someone open to being physically or emotionally wounded, like a newborn chick or an overly sensitive teenager. It costs Widgeco $2,000 to purchase a machine that produces widgets and $2.75 to produce each widget. If widgets are sold for $4.99 each, which of these represents the profit, P(w), received when Widgeco sells w widgets? Which event from the story shows that Braggers attitude about playing basketball is different from Kirbys? please help me answer this . An eagle is a predator for squirrels. A new law stops humans from huntingeagles, and the eagle population increases. What will happen to the squirrelpopulation?A. The carrying capacity of the ecosystem will increase.B. The squirrel population will increase.C. The ecosystem will reach Hardy-Weinberg equilibrium.D. The squirrel birthrate will decrease. For several hours you watch a group playing dice on the street and you notice that the owner of the dice often wins. Doyou conclude that he is just very lucky? In two r more complete sentences, explain why or why not you conclude thatthe owner of the dice is lucky. HELP IS THIS PROPORTIONAL RELATIONSHIP?! How would you summarize historan Eric foners perspective on Abraham Lincoln Help!!!!!!!!!!!!!!!!!!!!!!! x = y - 32x + y = 12 What were statues in a templecalled On the ancient Egypt?