Two students compare and contrast the composition of a plant and animals cells. Several observations are made during the investigation. Which observation is incorrect?
Plant and animal cell contain cell membranes.
Plant cell are contained within cell walls, while animal cells are not.
Plant and animal cells contain a nucleus.
Plant cell do not have cytoplasm.

Answers

Answer 1

Answer:

I believe the correct answer would be D- Plant cell do not have cytoplasm

Explanation:

Plant and animal cells both have a cytoplasm so D is the incorrect statement.

Answer 2

Two students compare and contrast the composition of a plant and animals cells. Plant cell do not have cytoplasm this observation is incorrect. Therefore, option D is correct.

What is cytoplasm ?

The liquid present inside a cell but not in the nucleus of the cell. In a cell, the cytoplasm is where the majority of chemical processes occur.

The gel-like substance that fills a cell is called cytoplasm. It serves as a catalyst for chemical reactions. It offers a foundation for other organelles to function within the cell. A cell's cytoplasm is where all the processes for cell division, growth, and replication take place.

Rudolf von Kölliker coined the phrase in 1863, first using it as a synonym for protoplasm, but over time it has come to refer to the cell's interior and extracellular organelles.

The first phase of cellular respiration, known as glycolysis, as well as mitosis and meiosis are just a few of the numerous cellular processes that take place in the cytoplasm.

Thus, option D is correct.

To learn more about the cytoplasm, follow the link;

https://brainly.com/question/15417320

#SPJ6


Related Questions

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D

If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False

Answers

I’m pretty sure it’s true. It makes the most sense.

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

Help ASAP, please
Thank you, Friends:)

Answers

irieirirkekeksksekekekekdjdjdjdkdkskdkdjdj

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

Select the statement(s) that is accurate about the immune system.

Answers

What’s the statements

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

The correct answer is - proteins.

Explanation:

All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.

Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species

Answers

C. beneficial to the ecosystem

Which factor listed below is abiotic? Bacteria, water, fungi, protists

Answers

Answer:water

Explanation:

Answer:

Water

Explanation:

Water does not contain cells, therefore it is non-living.

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland

Answers

Answer:

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.

The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

What do you mean by Endocrine Gland?

An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.

The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.

For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.

Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

To learn more about Endocrine glands, refer to the link:

https://brainly.com/question/4455660

#SPJ2

How many hydrogen bonds are present in the base pairing of guanine and cytosine?
3

Answers

Answer:

3 Hydrogen bonds

Explanation:

Cytosine and guanine pairing can be found in both DNA and DNA-RNA hybrid formed during replication and transcription. The two nitrogenous bases are held together by three hydrogen bonds.

Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle

Answers

Answer:

inner core

Explanation:

I looked it up

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.

Answers

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase a is converted (and inactivated) into the b form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase a, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase a.  

Mendel was a careful researcher who studied the inheritance of certain traits in garden peas. What are some of the research practices Mendel used? Choose all that apply.
A. He crossed true-breeding pea plants.
B. He allowed eggs to be fertilized only by self-pollination.
C. He analyzed his data mathematically.
D. He controlled variables by studying one or two traits at a time.

Answers

A. He crossed true-breeding pea plants

The research practices Mendel used is applies including A, B and C.

What is Mendel's experiment?

Mendel studied inheritance in peas (Pisum sativum). He chose peas because pea plant are easy to grow and can be sown each year. Pea flowers contain both male and female parts, called stamen and stigma, and can usually self-pollinate.

Mendel studied the inheritance of 7 traits in pea plants including height, flower color, seed color, and seed shape and each trait had 2 forms. He identified pure-breeding pea plants that consistently showed 1 form of a trait after generations of self-pollination.

Mendel proposed a theory of inheritance, based upon the observed data during his experiments, and a mathematical analysis of his results,

Thus, from above, the correct options include A, B and C whereas D doesnt apply because Mendel studied 7 traits at a time.

Learn more about Mendel' experiment, here; https://brainly.com/question/3056662

#SPJ2

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

Help stepbro im stuck in the washer

Answers

Answer:

I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn


"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"

Answers

Answer:

b is the answer my friend. hope this will solve your problem. mark me as brainliest

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

how is zero, oxidation numbers, and noble gases related​

Answers

Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.

hope this helps


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

Other Questions
An Internet service provider sampled 540 customers and found that 55 of them experienced an interruption in their service during the previous month. Construct a 95% confidence interval for the proportion of all customers who have experienced a service interruption. (0.080, 0.123) (0.873, 0.924) (0.076, 0.127) (0.102, 0.898) Explain in yourown words howyou would findthe density of aregular-shapedobject. What major policy of Sam Houston did Mirabeau Lamar oppose? a The need to increase public debt b The removal of the Native Americans from Texas c Recognition of Texas as nation by Mexico d The annexation of Texas by the United States Help is for today what is de correct 1. Find the probability that you will roll a six and then a five when you roll a die twice 2. A bag contains 3 red, 4 blue, and 6 yellow marbles. One Marble is selected at a time, and once a marble is selected, it is replaced, find each probability. help me plss im beeging Find the median and mean of the data set below:48, 50, 38, 4, 8, 46, 23 90S THINGS! I NEED AS MANY 90S THINGS LISTED AS POSSIBLE> WILL GIVE BRAINLIEST! no links plz1) Think of things that can go into a "90s song" about everything that's different now compared to then. (aka: paperboys, milkmen)2) list some things people did together daily in their homes. like watching tv together, having no phones etc!PLZ HELP WILL MARK BRAINLIEST- NO LINKS PLZ :) A plane traveled 1092 miles to Riyadh and back. The trip there was with the wind. It took 6hours. The trip back was into the wind. The trip back took 7 hours. Find the speed of the planein still air and the speed of the wind. Which of the following excerpts from The Things They Carried is an example of zeugma?A.Because the nights were cold, and because the monsoons were wet, each carried a green plastic poncho that could be used as a raincoat or groundsheet or makeshift tent.B.By daylight they took sniper fire, at night they were mortared, but it was not battle, it was just the endless march, village to village, without purpose, nothing won or lost.C.[H]e went down under an exceptional burden, more than 20 pounds of ammunition, plus the flak jacket and helmet and rations and water and toilet paper and tranquilizers and all the rest, plus the unweighed fear.D.Vaguely, he was aware of how quiet the day was, the sullen paddies, yet he could not bring himself to worry about matters of security. Read and asnwer:"Everbody in our family has different hair. My Papa's hair is like a broom, all up in the air. And me, my hair is lazy. It never obeys barrettes or bands. Carlos' hair is thick and straight. He doesn't need to comb it. Nenny's hair is slippery-slides out of your hand."Which of the following words has the most similar meaning and connotation and would BEST fit in the sentence to replace the word lazy. Group of answer choiceswork-shysluggishlistlessslothful Your class is studying recycling. On the one hand recycling can help protect the environment. On the other hand recycling is inconvenient and places an added burden on citizens.Do you feel recycling should be required of all citizens? Why?Write an essay persuading your legislator to accept your recommendation on whether or not recycling should be mandatory.Which of the following is the task for you?a. Write an essay persuading your legislator to accept your recommendation on whether or not recycling should be mandatory.b. Your class is studying recycling. On the one hand recycling can help protect the environment.c. On the other hand recycling is inconvenient and places an added burden on citizens. Do you feel that recycling should be required of all citizens? Why?Please select the best answer from the choices provided. Identify the lobe of the brain that is highlighted.a) frontalb) temporalc) occipitald) parietal I saw a really great action movie last night, you _____ see it. a) should b) had better Spanish 2 worksheet Will give brainlist! what is the total surface area? Students in middle school and high school were surveyed about whether they have taken the SAT. Some of the survey results are listed here.37% of middle school students have taken the SAT.4% of high school students have not taken the SAT.This information is shown in the two-way frequency table below. Drag numbers into the empty spaces to complete the table. What did the preacher want Tom Joad to do What is the creative strategy for music application. What is the output is 2 less than twice the input.