What are the locations and end products for the processes of transcription and
translation?

Answers

Answer 1
Transcription is the synthesis of RNA from DNA. Occurs in the nucleus. Translation is the synthesis of a protein from RNA. Occurs in the cytoplasm.
Answer 2

The cytoplasm is the site of translation, the next process that converts a gene into a protein. In order to “read” the sequence of mRNA nucleotides, the ribosome, a specialized complex, interacts with the messenger RNA.

What is role of gene expression in an organism?

It serves as both a volume control that raises or lowers the level of proteins produced, and an on/off switch to regulate when proteins are created.

Because a particular protein can only be made when its gene is turned on, gene expression is significant.

But the process of turning a gene into a protein involves numerous steps, and one of these phases—the production of proteins—is essential for the gene expression pathway that can be altered in cancer.

Therefore, transcription occur at nucleus and translation take place in cytoplasm.

Learn more about gene expression here:

https://brainly.com/question/14182257

#SPJ6


Related Questions

Is nature or nurture more important

Answers

Answer:

Yes

Explanation:

cus

it keeps us alive

The answer is completely subjective. I’ll assume you are talking about raising children simply because this vocabulary is often used in that case.

Nature can go from describing events out of our control, innate feelings, to describing the area we are raised in. Nature can go a long way with raising kids, in comes the theory’s of the “murder gene.” The aforementioned gene is a theory on the “murderous” behaviors in children sociopaths, or psychopaths. This theory exists because of some unexplainable behaviors the children have that were not taught, like hurting animals and lack of empathy.

In a more lose interpretation of Nature it can mean the area children are raised in. Like the different between a trailer park and a mansion. But generally Nature refers to innate, uncontrollable, behaviors.


On the other hand Nurture refers to the actual raising of the child. Referring back to the “murder gene” the question is if you could reverse the effects of the gene in children based on how you raise them. Nurture is also an argument for how kind you should be to your child as they are growing.

Personally I think Nurture is more important, but in all actuality a good balance is best.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

X could be an Arecaceae

Both roses and ferns are used as ornamental plants

Explanation:

Hope I got this right!! I really love plants! aslo feel free to report this answer if I was wrong!


Why must an mRNA copy be made for Protein Synthesis?
A. Ribosomes cannot read DNA, only RNA.
B. DNA must stay inside the nucleus.
C. Ribosomes are too big to enter the nucleus.
D. DNA is too degenerate to use without mRNA.

Answers

Answer:

A

Explanation:

its not D or C and B might be true but its A okay

Why must an mRNA copy be made for Protein Synthesis because C. Ribosomes are too big to enter the nucleus

Why is mRNA important for protein synthesis?

mRNA is the molecule that includes the message contained within DNA to the ribosome. Ribosomes are where proteins are produced. mRNA is vital because ribosomes cannot attain the DNA inside our cell nucleus, which is the region within the mobile wherein DNA is housed.

Why is it important to make an mRNA reproduction of a DNA gene earlier than protein synthesis?

So as for cellular to fabricate these proteins, particular genes inside its DNA should first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into completely useful proteins.

Learn more about Ribosomes at https://brainly.com/question/8773679

#SPJ2

1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.

Answers

Answer/Explanation:

During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.

But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.

The simplest structures that can carry out all of the activities characteristic of life are:
A. cells.
B. atoms.
C. molecules.
D. crystals.

Answers

atoms as they are the simplest

What is the energy source that allows photosynthesis to occur?

Answers

Answer:

[tex]\boxed {\boxed {\sf The \ sun }}[/tex]

Explanation:

Photosynthesis is a special process that certain organisms (plants, algae, and some bacteria) undergo to create "food".

This turns light energy, carbon dioxide, and water into glucose and oxygen. The glucose becomes the food for the organism, because it is turned into ATP during cellular respiration. The ATP is energy that fuels the processes, like growth, repair, and transport.

This process occurs because of the sun. It provides the light energy needed for the reaction. Organelles inside of the cells, called chloroplasts, contain a pigment (chlorophyll) that captures this energy.

Which choice correctly summarizes meiosis into one statement?

Answers

Answer: D

Explanation:

If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

Which antivenom will save Tyler?

Select one:

a.
Antivenom A


b.
Antivenom B


c.
Antivenom C


d.
Antivenom D

Answers

the answer is anticenom A

Answer:

A

Explanation:

It is A

All living organisms store genetic information that can be passed on from parent to offspring. How does the biomolecule responsible for storing this information differ from other biomolecules?

Answers

Answer:B

Explanation:

What type of cell is more likely to replicate and replicate faster brain cell or hair cell

Answers

Answer:

hair cells is most likely to replicate faster than the brain cell

Explanation:

__________

Rivers that have developed over a long period of time are found in wide valleys with flat, low-lying bottoms. These valleys were
created by the removal of rock and soil through the process of _____.
OA. deposition
B
C. erosion
•D. weathering
glaciation

Answers

Option C i thinkkkkk

Color blindness is a X-linked recessive trait. A couple want to predict whether it would be possible for their child to be color blind. The female is an unaffected carrier and the male is red/green color blind. What percentage of offspring would be color blind? ​

Answers

Answer: There is a probability (n.b. NOT certainty) that half of all offspring will be colour blind.

Explanation: The female is XX and as an unaffected carrier we can assign genotype Cc where c is the recessive allele.

The male is XY and colour blind, so genotype cY

Male offspring can be cY or CY so p|colourblind = 50%

Female offspring can be Cc or cc so, again p= 50%

If there is also equal probability of sex of the offspring, there is an overall probability that half the offspring will be colour blind

What agent of erosion is this? Gravity,wind, waves, running water or glaciers.

Answers

Answer:

wind                                        

Explanation:

What is antibiotic resistance and why should we be
worried?

Answers

Answer: Antibiotic resistance is when bacteria develops a resistance or an immunity against antibiotics. If this evolution/adaptation becomes widespread, our healthcare system could see a mass rise in deaths due to us not being be able to effectively treat the bacteria which is causing harm.

Explanation:

I learned about this

The _______________ rate describes the rate at which the atmosphere gets colder as the air gets thinner at higher altitudes.

Answers

Answer:

Lapse rate

Explanation:

AHHHHSHYNJTNXT WHYYYYY

During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a △G of -20 kcal/mol. If you double the amount of enzyme in the reaction, what will be the △G for the new reaction?


A. +20 kcal/mol

B. -40 kcal/mol

C. -20 kcal/mol

D. -10 kcal/mol

Answers

Answer:

Option-C

Explanation:

Delta G (△G) refers to the overall energy released during a chemical reaction when equilibrium is reached i.e the rate of conversion of product into the substrate is equal to the rate of conversion of substrate into product. Thus, △G accounts for the equilibrium of the reaction.

In the given question, it has been mentioned that △G of a reaction is -20 kcal/mol then how will it change if the amount of enzyme is doubled.  

The △G is not affected by the enzyme concentration as the presence of enzyme affects the G (Gibbs free energy) and activation energy.

Therefore, △G will remain the same even if the amount of enzyme is doubled i.e -20 kcal/mol will be the correct value.

Thus, Option-C is the correct answer.

which level of the food chain is most affected by biomagnification

Answers

Answer:

animals near the top of the food chain are most affected because of a process called biomagnification. Many of the most dangerous toxins settle to the seafloor and then are taken in by organisms that live or feed on bottom sediments.

Explanation:

Have a great one!

Which person is collecting data through the participant observation method?
O A. William, who is reviewing the comments people wrote on
questionnaires
B. Dakota, who is calculating the results from a survey
OC. Hosea, who is watching people in their normal suroundings
OD. Brittany, who is reading research done by others

Answers

Answer:

C. Hosea, who is watching people in their normal surroundings.

Explanation:

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

The cell part that helps with cell division is the ________​

Answers

Answer:

centrioles

Explanation:

Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.

Where do the mineral resources in which society depends on come from

Answers

Answer:Without minerals we would not have electricity, food, or shelter. Minerals make today's technology-based life possible, but that's something many of us take for granted.

Explanation:Soil, rocks, and minerals provide essential metals and other materials for agriculture, manufacturing, and building. 7.7. Earth scientists and engineers develop new technologies to extract resources while reducing the pollution, waste, and ecosystem degradation caused by extraction.

DNA analysis has little to offer from forensic science
true or flase​

Answers

Answer:

DNA analysis has little to offer forensic science is false.

Explanation:

DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis

Why might Ponyboy have idolized Pual Newman?

Answers

Ponyboy might have idolized Paul Newman because Paul Newman played many rebellious characters who Ponyboy could relate to. Some characters he played were “Fast Eddie” in The Hustler and a Southern chain gang member in Cool Hand Luke.

How is the Grand Canyon related to volcanic activity?

Answers

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River. ... 1064 a series of eruptions built the park's namesake cinder cone.

hope this helps ^^

Answer:

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River.

Explanation:

What process in humans is a good representation of asexual reproduction?

A. Meiosis

B. Mitosis

C.Fertilization

Answers

Answer:

B.

Explanation:

PLEASE ASAP NEED HELP PLEASEEE !!!!

Answers

Answer:

Hunting in groups,  keen eyesight, chemicals to paralyze prey

Explanation:

Answer:

Hunting in groups

Keen Eyesight

and Camouflage

Explanation:

These are all the main adaptations that predators are born with. The rest of them do not help them at all. PLease give brainliest :)

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

Can someone help me thank you!!

Answers

Answer:

CARBON

Explanation:

Other Questions
50 pointsmost faumus woman in america book for a complete version of this text.Which statement is a main idea of The Most Famous Woman in America?Barton saves lives by convincing the army to treat the wounded at the battlefields fronts. When speaking in public, Barton sometimes feels shy. Barton is in charge of army doctors and surgeons working on the battlefields. As a child, Barton becomes an expert horseback rider and skilled athlete. Whats Your Fav NBA team :D Another term for a city and the surrounding land it controls is What are somethings about the Heliocentric model? Where do we see the government abusing power? What is one thing that we can do as a community to be more inclusive towards lgbtqia people? PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System Assume the random variable x is normally distributed with mean u = 82 and standard deviation o =5. Find the indicated probability 1 of 10FactoriseC2 491 isaac walks 6/10 of a mile in 1/5 of an hour. if his rate remains constant what is the walking rate in mph? how does paragraph 4 contribute to the development of the themeof the story?Mrs. Pynchum kept the poor-farm, and Gobaly was towns poor. The boys sometimes called him that, when he went to coast on Three-Pine Hill or to see the skating on the mill-pond; and sometimes, too, they made fun of his clothes. But it was only the boys who were a great deal bigger than he who dared to make fun of Gobaly, and some of them even ran when he doubled up his fists. But Methuselah!5 I dont know what would have become of Methuselah if he had not had Gobaly to defend him. For he was a delicate little fellow; spindlin and good for nothin, Mrs. Pynchum called him; and he had come to her in a basket in other words, Methuselah was a foundling. Mrs. Pynchum didnt think much of children who came from nobody knew where. It didnt seem to belong to Poplarville to support him, since he didnt belong to anybody that ever lived there, and his keep and his medicine cost more than he would ever be worth, to anybody. ill give you brainliest Emma wrote a composition about humpback whales Select all numbers that have an absolute value of 0.75.Choose all answers that apply:75B7.5-0.75D0.75 Jennifer deposits $80 into an investment account with a rate of 4%, compounded annually. The equation y = 80(1 + 0.04)x can be used to determine the number of years, x, it takes for Jennifers balance to reach a certain amount of money, y. Jennifer graphs the relationship between time and money. What is the y-intercept of Jennifers graph?(0, 80)(0, 0)(80, 80)(80, 0) i really need help pls Simplify the expression -5.5(2 - 6x) - 2.5x Ral y Raquel __________ enojados hoy.estsestoyestamosestn What can be caught but never thrown? Where is Shakespeare buried