What is cystic fibrosis at least five 5 conceptos

Answers

Answer 1

Answer: There are five concepts of cystic fibrosis. They have

People with CF can't be together.CF and Tay Sachs are tied to fatal Jewish genetic diseases.Our skin is super salty.We are master deceptors.The nickname for CF is 65 roses.

Explanation:

1. People with CF can't be together.

              The thick, sticky mucus that builds up in our lungs functions like silly puddy. So, when bacteria enter our lungs, they tend to stick around forever whereas healthy people’s immune systems can fight them away. As a result, people with CF harbor dangerous bacteria in their lungs, which are contagious only to other people with CF or compromised immune systems.

The excellent news is CF is not at all contagious or dangerous to healthy people. The bad news is the cross-infection risks mean people with CF are advised not to be within 6 feet of one another.

In response, we’ve formed thriving online communities so that we can benefit from information sharing and support, but there’s no denying that virtual connections can never replace in-person ones. For me, this is one of the hardest things about CF.

2. CF and Tay Sachs are tied as fatal Jewish genetic diseases.

                   When you think of fatal Jewish genetic disease, you think “Tay Sachs,” right? But the truth is that approximately one in 25 to 27 Ashkenazi Jews is a carrier of CF, making it just as prevalent as Tay Sachs. That’s why Emily’s Entourage is on a mission to get the word out to the Jewish community that CF is their disease, too.

3. Our skin is super salty.

           

                          Back in the day, salty skin was the hallmark characteristic of CF. The reason is that a faulty salt chloride channel causes people with CF to excrete too much salt. In other words, when we sweat, we lose too much salt, which puts us at an increased risk of dehydration.

If it’s hot outside and you lick the skin of someone with CF (with permission, of course!), you’ll taste how salty they are! You may even see salt crystalize on their skin.

To this day, the diagnostic test for CF is called a “sweat test” because it measures the salt chloride levels in your sweat.

4. We are master deceptors.

                       CF is an invisible disease, which means that, as sick as our lungs and other organs are on the inside, you can’t tell from the outside. Just from looking at me, you’d probably never guess that I have less than a third of the average lung function or that I’m teetering on the brink of lung transplant evaluation.

This is a blessing and a curse. The downside is that it is often hard to appreciate how sick we feel and how difficult everyday tasks are because we look so deceivingly healthy on the outside. But on the flip side, it’s nice not to wear our disease on our sleeve, so to speak, so people see more than just our disease when they look at us. Plus, looking healthy rather than sickly is generally a good thing.

5. The nickname for CF is 65 roses.

                      Way back when children with CF had trouble pronouncing “Cystic Fibrosis.” So, they came up with a nickname with a similar ring: sixty-five roses. Roses certainly evoke a much lovely image than a life-threatening disease. In fact, the nickname stuck so much that it is still used today and roses have become an unofficial symbol of CF.


Related Questions

If the female is a carrier for the x-linked trait for colorblindness, and the male is colorblind, what percentage of their daughters wilI be colorblind?​

Answers

Answer: 50%

Explanation: I used Punnet squares and past answers.

considering I used past answers it has to be correct. (the past answers were from less than a week ago)

In addition to seeds, which of the following characteristics is unique to the seed-producing plants?
A) sporopollenin
B) lignin present in cell walls
C) pollen
D) use of air currents as a dispersal agent
E) megaphylls

Answers

pollen is unique to the seed producing plants

Which is the odd one out - ant, ostrich, prawn, snake, turtle

Answers

Answer:

Ostrich

Explanation:

Ant, prawn, snake and turtle are all poikilothermic (or cold-blooded) whereas ostrich is an endotherm (or warm-blooded) making it the odd one out.

The options given are cold blooded animals along with one odd option. The correct answer is ostrich.

What is the class of ostrich ?

Ostrich is the largest bird. It lays largest eggs and the ostrich are the birds that can not fly as they are very heavy in weight. It belongs to the class aves.

Ostrich is a bird that is poikilothermic in nature. Birds are poikilothermic that is warm blooded. Birds have the  warm blood and these are able to maintain their warm temperature, these are ectothermic in nature. In case of reptiles and insects where the class reptilia and the class insecta are the species to which the remaining belong to.

The only different is that the ostrich is poikilothermic in nature that is it is warm blooded in nature. The other reptiles and insects are cold blooded that is endothermic in nature.

Learn more about poikilotherms at :

https://brainly.com/question/18566936

#SPJ2


Which of these examples involves a human body organ creating a force?
A The skin produces sweat on a hot day to help cool the body off.
B
C
The brain sending electrical impulses
The stomach releasing gastric acid to help break down food
D The heart pumping blood through the veins

Answers

Answer:

D

Explanation:

The heart is a muscle that physical contracts to force blood through the human body. I'm around 90% it is D.

The Biomes of Bolivia and the world​

Answers

The Biomes of Bolivia and the world

Biomes are characterized by grouping ecosystems with similar characteristics, in climate, fauna, flora and soil.

¿What is the Biomes of Bolivia and the world?

For Biomes are characterized by grouping ecosystems with similar characteristics, in climate, fauna, flora and soil.

the process of oxygen depletion due to nutrients such as nitrogen and phosphorous entering marine systems and causing algal blooms is called _______.

Answers

Answer:

the process of oxygen depletion due to nutrients such as nitrogen and phosphorous entering marine systems and causing algal blooms is called Eutrophication

Eutrophication is the oxygen depletion process that occurs due to nutrients such as nitrogen and phosphorus in the marine system resulting in algal blooms.

Eutrophication is a main problem in the aquatic ecosystem. It occurs when the lake or estuaries are rich in nutrients like nitrogen and phosphorus.

The deposition of these nutrients in water bodies occurs because of the surface runoff of agricultural lands.

These nutrients are required by microorganisms, phytoplankton, and algae for their growth. So they consume these nutrients and grow enormously and cover the lake as a green meadow or algal bloom.

So the sunlight or oxygen can't reach underwater. As a result, the aquatic organisms begin to die.

To know more about algal bloom:

https://brainly.com/question/17021907

As a result of an action potential, AcH is released from the axon terminal and attaches to receptors on the motor end plate. Sodium rushes in the T-tubules and all the steps occur until the muscle contracts in the leg and carry out the command transported by the motor neuron. Which gray horn is the cell body of the motor neuron located? Infer and explain if this is a positive or negative feedback

Answers

Acetylcholine (ACh), a chemical transmitter, is released into the synaptic cleft. ACh diffuses through the postsynaptic or post junctional membrane and binds to specific receptors there.

What is chemical transmitter?

Chemical transmitter is defined as a signaling substance that a neuron secretes in order to influence another cell across a synapse. Typically, a transmitter transforms the sensor's output into a signal level fit for a controller's input.

Exercise causes the skeletal muscles to contract and alter. Acetylcholine, a neurotransmitter, is produced from nerve endings and binds to receptors called AChRs on the surface of muscles in (A). Sodium channels activate as a result of the subsequent depolarization, triggering an action potential that travels throughout the cell.

Thus, Acetylcholine (ACh), a chemical transmitter, is released into the synaptic cleft. ACh diffuses through the postsynaptic or post junctional membrane and binds to specific receptors there.

To learn more about chemical transmitter, refer to the link below:

https://brainly.com/question/2084370

#SPJ1

Which of the following is
true about bacteria?
A. They lack DNA.
B. They are single-celled organisms.this
C. They have membrane-bound organelles.
D. They are eukaryotes.

Answers

B is the answer I checked
B. They are single celled organisms (:

7. Which landform is the result of glacial erosion?
A. a horn
B. a moraine
C. an outwash plain

Answers

Answer:

i believe its  A.horn

Explanation:

hope this helps ya;)

5. A man with group A blood marries a woman with group B blood. Their child has
group O blood. What are the genotypes of these individuals? What other
genotypes and in what frequencies, would you expect in offspring from this
marriage.

Answers

If a child with blood group O is born to the parents with blood group A of father and B of mother, then their genotype will be [tex]I^{A} I^{i}[/tex] and [tex]I^{B} I^{i}[/tex] respectively.

Blood group is the type antibodies and antigens present in the blood of the individual. These antibodies and antigens are heritable and transferred from the parent to the child in the form of genes. There are 4 types of blood groups. These are: A, B, AB and O.

Genotype is the genetic composition of an individual. It can off the whole genome or for a single trait. When the genotype [tex]I^{A} I^{i}[/tex] and [tex]I^{B} I^{i}[/tex] are crossed they have the potential to give birth to a child with genotype [tex]I^{i} I^{i}[/tex], and this justifies the birth of child with blood group O.

To know more about genotype, here

brainly.com/question/410918

#SPJ1

Put the following events of translational elongation (the stage in translation that occurs after initiation) in the order that they occur, beginning with the first step at the top.
1. The ribosome moves down the mRNA by one codon, and a tRNA carrying the third amino acid comes into place.
2. After the first amino acid has been brought to the ribosome, a tRNA carrying the second amino acid of a protein binds to the second codon.
3. A covalent bond forms between the first and second amino acids.
4. The ribosome releases the first tRNA.
5. The ribosome releases the second tRNA.
6. A covalent bond forms between the second and third amino acids.

Answers

The following events of translational elongation (the stage in translation that occurs after initiation) in the order that they occur, beginning with the first step at the top.  A covalent bond forms between the first and second amino acids.

At some stage in translation elongation, the ribosome ratchets along its mRNA template, incorporating each new amino acid and translocating from one codon to the next. The elongation cycle requires dramatic structural rearrangements of the ribosome.may additionally nine, 2014

Translation elongation calls for particular aminoacyl TRNAs being escorted to the ribosome with the aid of GTP-coupled elongation factor. Elongation calls for movement alongside the ribosome-coupled mRNA, three nucleotides at a time to add amino acids which have been certain to TRNAs.

In the elongation step, the extending of the amino acid sequences and the formation of the amino acid chain is formed. This step is one of the primary and larger steps in translation wherein some of amino acids are delivered to the chain and related collectively with the aid of peptide bonds to form polypeptide bonds.

Learn more about translational elongation here:

https://brainly.com/question/13689919

#SPJ4

Unlike perennials, annuals
A. must be grown in handing baskets
B. Cannot be grown in the sun
C. Need plenty of shade
D. Finish their life cycles in a year

Answers

D. Finish their life cycles in a year.

Using the following genomic sequence:

1) Underline each intron

2) Circle each exon


UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG

AUAAUGUUUUUACCCACCAACGACGCCAUGUGACGUCGAAUGACUACCAAUGCU

GCUGGACUAACAUAAUCGUAUGGAAGGGUGUCAAUGUUCUCCUAUGUAAUGUAA

CAUAAU

Answers

Intron are underlined and the Exon circled (in brackets)

(UUU)(AUG)(ACU)(AAU)(GAU)(GAA)UAA(UAU)(AUG)(AUG)(CGU)(AGU)(AAU)(CCU)(UCU)(GCA)(GAU)UAG

(AUA)(AUG)(UUU)(UUA)(CCC)(ACC)(AAC)(GAC)(GCC)(AUG)UGA(CGU)(CGA)(AUG)(ACU)(ACC)(AAU)(GCU)

(GCU)(GGA)(CUA)(ACA)UAA(UCG)(UAU)(GGA)(AGG)(GUG)(UCA)(AUG)(UUC)(UCC)(UAU)(GUA)(AUG)UAA

(CAU)(AAU)

What is genomic sequencing?

The method used in the laboratory for determining the genetic make up of any organism or their cell type is called genomic sequencing. Genes are made up of introns and exons which are nucleotide sequences.

Introns are none coding sections of heterogeneous nuclear RNA and are removed by splicing as the RNA matures while exons are present in messenger RNA that encodes the amino acids of protein. Genes have various exons that bear introns linking them.

Learn more on genomic sequence here: https://brainly.com/question/29316113

#SPJ1

How does a cell know when to divide, when to duplicate its chromosomes, or when to enter another stage of the cell cycle.

Answers

A cell knows when to divide when to duplicate its chromosomes, or when to enter another stage of the cell cycle by communicating with each other using chemical signals from special proteins called cyclins.

Cells control their division by exchanging chemical signals via unique proteins called cyclins with one another. These signals function as switches that inform cells when to begin dividing and then when to stop.

A cell has to go through a number of checkpoints in order to transition from one stage of its life cycle to the next. Specialized proteins inspect each checkpoint to see if the required circumstances are there. If so, the cell can move on to the following stage.

In order for each new cell to include all of the necessary genetic information, the genes must also produce copies of themselves prior to cell division.

To learn more about Cell visit: https://brainly.com/question/1303025

#SPJ1

Select all that apply.
Proteins____

A. contain carbon, hydrogen, oxygen, and nitrogen.

B. consist of amino acids

C. are derived from fruits and vegetables

D. are part of antibodies

Answers

Answer: the answer is option are option B and C.

Explanation: Proteins are made up of bulk units of amino acids progressively in our body, which are connected to each other as one long chain.

there are 20 different amino acids that compose the proteins, they can be derived from fruits and vegetables.

to know more about proteins,

brainly.com/question/28870428

what is the location of most of the organelles and where most of the cell processes take place?

Answers

The Cytoplasm is the location of the most organelles where most cell processes take place.

Answer:

the cytoplasm

Explanation:

All organisms use respiration, but?

Answers

certain types of bacteria and yeasts
bacteria and yeast ….

Cell membranes are made mostly of _____.

Group of answer choices

A. oxygen

B. phospholipids

C. sugar

D. water

Answers

Answer:

B. phospholipids

Answer: Phospholipids

Explanation: Phospholipids are a major component of cell membranes. It's also known as a lipid bilayer.

A
B
Which type of bacteria
stain purple during Gram
staining?
Gram-negative bacteria
Gram-positive bacteria this

Answers

Answer:

b) Gram-positive bacteria

Explanation:

Gram-positive bacteria stain purple during Gram staining. Gram-negative bacteria turns into red (or) pink. Therefore, the option (b) is the correct answer.

Which of the following is
TRUE about viruses?
A. Viruses CANNOT be cured by
antibiotics. This
B. Viruses are easily cured by
antibiotics.
C. All viruses can be cured by
antibiotics.
D. Many viruses are able to be cured
with antibiotics.

Answers

Answer:

A. Viruses CANNOT be cured by

antibiotics

Explanation:

Answer:

a) Viruses cannot be cured by antibiotics.

Explanation:

"Viruses cannot be cured by antibiotics" is true about viruses. Because, the antibiotics can only cure bacterial diseases. Hence, the option (a) is the correct answer.

Kinetic energy depends on
O Heat and pressure
Density and volume
O Mass and speed
Position and height
22:

Answers

Mass and speed is what the kinetic energy depends on

Which example displays a type of point source pollution?
• A.
rainwater carrying toxic chemicals and debris to a river
B.
melted snow mixed with debris flowing into a city
C.
untreated water from a factory flowing into a lake
D.
smoke released by trucks
E
rainwater mixing with garbage on the sidewalks of a street

Answers

The example displaying a type of point source pollution is: (C) untreated water from a factory flowing into a lake

Pollution is the presence of contaminants in the environment. The pollution can be of air, soil, water, or even noise. The major cause of pollution is the human action and synthetic substances but some natural products can also be the causing agent of pollution.

Point source pollution is the one spread through one single source like pipe, ship or factory smokestack that pollutes a larger area. Like untreated water from factories can pollute the entire water body. Similarly chimney smoke of industries can pollute the air of whole city.

To know more about pollution, here

brainly.com/question/23857736

#SPJ1

In a particular strain of mice. Fur coat color is either black or brown, where black
(B) is dominant to brown (b). A homozygous dominant mouse mates a mouse with
brown fur.
What are the genotypes of the two individuals?
What proportion of their offspring will have black fur?

Answers

BB or Bb is the genotype of the two individuals. More than 90% proportion of their offspring will have black fur.

Black mice must have at least one B allele since the color is dominant. Either BB or Bb could be their genotype.

Because every offspring will have at least one dominant allele for black fur, which will outweigh any allele for brown fur, it is expected that all offspring will have black fur, so the proportion will be more than 90%.

The mix of genes found in the sex cells or gametes (ova and sperm) that were used in a child's conception determines the genotype of that child. From each parent came one sex cell. The gene for each attribute is often only present in one copy in sex cells.

To learn more about Genotype visit: https://brainly.com/question/16882362

#SPJ1

A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER). Which of the following functions is this cell type most likely specialized to perform?
A. The production and secretion of steroids
B. The destruction of toxic materials produced in other cells of the organism
C. The synthesis of polysaccharides for energy storage
D. The production and secretion of proteins

Answers

A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER). Which of the following functions is this cell type most likely specialized to perform?

A. The production and secretion of steroids

B. The destruction of toxic materials produced in other cells of the organism

C. The synthesis of polysaccharides for energy storage

D. The production and secretion of proteins

Hope this helps :)

How has the flow of carbon changed between the atmosphere and plants?

Answers

Answer:

Plants on land have taken up approximately 25 percent of the carbon dioxide that humans have put into the atmosphere. The amount of carbon that plants take up varies greatly from year to year, but in general, the world's plants have increased the amount of carbon dioxide they absorb since 1960

Explanation:

For example, in the food chain, plants move carbon from the atmosphere into the biosphere through photosynthesis. They use energy from the sun to chemically combine carbon dioxide with hydrogen and oxygen from water to create sugar molecules.

I just searched up Hope it helps!

Which of the following statements about mutations is false?

a. Addition and deletion mutations disrupt the primary structure of proteins.
b. An addition mutation results in an added base in the DNA sequence.
c. A deletion mutation results in the loss of a base in the DNA sequence.
d. A knock-out mutation results in a total absence of the mutated protein.

Answers

The false statement about mutations is: A knock-out mutation results in a total absence of the mutated protein.

Altering the genome's nucleic acid sequence of an organism, virus, or extrachromosomal DNA is known as a mutation.

Knock-out mutation refers to a DNA change that completely halts a gene's expression. In all types of cells and creatures, this is achievable using certain genetic techniques. CRISPR genome editing is currently the quickest and most direct method for accomplishing precise gene knockdown.

To learn more about Knock-out mutation click here,

https://brainly.com/question/29361996

#SPJ4

what is a good answer to ape theory

Answers

We do share a common ape ancestor with chimpanzees. It lived between 8 and 6 million years ago. But humans and chimpanzees evolved differently from that same ancestor. But we are not descended from monkeys or any primate living today

Hope this helps:)

The circulatory system delivers hormones released by the ______________________ system to the body.

The person who gets it correct get brainly

Answers

endocrine system

sends signals in the form of hormones to the body. The endocrine system controls growth, reproduction and metabolism. Organs: glands, hormones.

Hope this helps:)
The answer is endocrine system

Temperature below the freezing point of water

Answers

The freezing point of water is 32 degrees

Directional Terms Please Im not good at biology could anyone help me pls?

Answers

Answer: c

Explanation:

cause

Other Questions
What is the third step of effective communication? a. Be clear about your goals. B. Choose effective words. C. Be aware of feedback. D. Understand your receiver. Please select the best answer from the choices provided a b c d. 4 students have different heights. Their average is 64.5 inches. The shortest is 62 inches and the tallest is 68 inches. If the middle two have the SAME height, how tall are each of them?Please help, 50 points. Show your work!!! I need it or I wont get a mark. Which BEST explains why reading out loud helps visual learners?A.It requires them to look at every word.B. It is an effective technique for all learners.C.It is important that visual learners hear the words.D.It does not-this technique is for auditory learners. dr. garcia is interested in the genetic and environmental influences on musical ability. which of the following methods would be most useful for determining how heritable musical ability is (i.e. how much it depends on genes vs. environment)? What was Carr's argument in Baker v Carr? a tank is filing with petrol at rate of 35 litre per minute. the tank already had 10 liters in it before the filling began. write an equation in standard form for this situation. pls help ill give brainliest Your friend asks you to help him study and will pay you 5 dimes the first time you help him. You agree to help if he multiplies your payment by 5 for each study session. After 2 study sessions, you will receive 25 dimes, and after 3 study sessions, you will receive 125 dimes.Complete and solve the equation that finds the number of dimes he will pay you after the 7th study session Look at the rock layers in the image. Which statement is true about the ages of the rock layers?A. Layer A is oldest and layer D is youngest.B. Layer D is oldest and layer A is youngest.C. Layers A and D are the same age.D. Layer's A, B, C, and D are the same age. the home health nurse is watching the caregiver change the sternotomy dressing on the postoperative client. which action by the caregiver identifies correct principles of infection control? in an ice sheet or ice cap, the movement is downward and outward from a central high area toward the edges of the glacier. 7. What is the dependent variable for the function g(t)=-t-10?Ot10O-t09A What is the domain of the function shown in the graph below?{x|x>-4}{x|x -4}{yly 2} Wyatt went to the grocery store and bought bottles of Soda and bottles of juice. Each bottle of Soda has 30 grams of sugar and each bottle of juice has 40 grams of sugar. Wyatt purchased 2 more bottles of juice than bottles of Soda and they all collectively contain 430 grams of sugar. Write a system of equations that could be used to determine the number of bottles of Soda purchased and the number of juice purchased. Define the variables that you used to write the system. Work out the percentage increase in her total hours from Weekend 1 to Weekend 2 the practice of product counterfeiting has spread to high-technology products and services from the traditionally counterfeited products: high-visibility, strong-brand-name consumer goods. -2f-3.7 Nasa believes a large section of the destroyed space shuttle challenger has been found where?. Which frame(s) represent(s) conditions suitable that would support submerged plants and invertebrates that can tolerate a sandy bottom? Choose all that apply a 7.5 percent coupon bond with nine yars left to maturity is priced to offer a 10.4 percent yield to maturity. you believe that in one year, the yield to maturity will be 8 percent. what is the change in price the bond will experience in dollars