What is ischemia?
O medication to treat myocardial infarctions
O type of heart damage
O branch of the coronary arteries
O insufficient blood supply to the heart
PLEASE HURRYYYYY

Answers

Answer 1

Answer:insufficient blood supply to the heart

Explanation:

Answer 2

Answer:

insufficient blood supply to the heart or other organs


Related Questions

MEDICAL TERMINOLOGY!!

Answers

Medical terminology is language used to precisely describe the human body including its components, processes, conditions affecting it, and procedures performed upon it. Medical terminology is used in the field of medicine.

NAME THIS SONG AND ARTIST
Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself

Answers

it’s karma police by radiohead c:
KARMA POLICE BY RADIOOOO HEADDDD

The main idea behind Maslow’s hierarchy of needs is that
the most important needs must be met before the less important human needs can be met.
all needs are equally important and must be met simultaneously to achieve full health and success.
there are a few less important needs that must be met before the many important needs can be met.
all needs are equally important and their ability to be met can vary in timing.

Answers

first one fits best!

Answer:

It is A!!!!

Explanation:

Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional

Answers

the fourth one is correct
The answer is D!!!!!!!!

Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane

Answers

An eye on each side of the sagittal plate
2./ B. an eye on each side of the sagittarius plane

Complete the sentence to describe a procedure for food animals. Bulls are to improve the quality of beef, and to make the animals easier to manage.

Answers

Answer:

Castrated

Explanation:

Castration of bulls: Bulls or male calves are castrated to improve the quality of beef. This procedure also makes the animals less aggressive towards the rest of the herd.

why are technical schools established?​

Answers

It established vocational education as acceptable training for certain future professionals who wouldn't need bachelor's degrees to do their jobs, such as plumbers, mechanics, and factory workers. They completed their training in focused vocational programs associated with high schools.

Going about her cleaning routine as usual, Jayla sprays an aerosol bleach cleanser in her bathroom and then leaves to let it air out before she scrubs it down. Only two or three minutes later, she notices her cat, Grimaldi, fleeing the bathroom, coughing. Jayla hadn’t realized that Grimaldi was in the bathroom when she sprayed the chemical, so she rushes over to check on him. He seems to be wheezing and shaking a bit. Calling the vet, he asks Jayla to explain how Grimaldi was exposed to the chemical. Hearing Jayla’s explanation, which method of poisoning will the vet MOST likely assume Grimaldi is dealing with?

ingested poison

absorbed poison

injected poison

inhaled poison

Answers

Answer:

inhaled poison

Explanation:

Grimaldi was inside the bathroom when Jayla sprayed the aerosol bleach cleanser. The molecules of this cleanser spread quickly through the surroundings. Since the cat was inside the bathroom, it could have inhaled the bleach and the poison reached its lungs. This caused symptoms of wheezing, which is respiratory in nature, and shaking (seizures). Inhaling a poison leads to difficult in breathing among animals because it can cause the lungs to be inflamed.

Inhaled. This one was easy!

Use the drop-down menus to select the best
answers.
Some myocardial infarctions involve erratic heart
behavior, such as

1.creating more carbon dioxide.
2.missing beats.
3.producing more oxygen.
4.pumping more blood.

PLEASE HURRY

Answers

number two! good luck!

Answer:

Explanation:

the second part is cardiac arrest

Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.

For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.

After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.

Answers

Answer:

Focus on the issue, not the person. ...

Be genuine rather than manipulative. ...

Empathize rather than remain detached. ...

Be flexible towards others. ...

Value yourself and your own experiences. ...

Use affirming responses.

Meet regularly. Hold regular strategy meetings for the entire team. ...

Be inclusive. ...

Be transparent, clear and concise. ...

Show some respect. ...

Recognize that being right may be wrong. ...

Use online collaboration tools.

Explanation:

''.''

Size-wise, your heart occupies about_____ of the space in your upper chest.

A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th

Answers

Answer:b

Explanation:

Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

What is heart?

Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.

The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.

Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.

To learn more about heart, refer to the link below:

https://brainly.com/question/16566688

#SPJ2

What is the healthy percentage of body fat for men?

Answers

Answer:

The answer would be 18-24%.

Explanation:

The amount of essential fat differs between men and women, and is typically around 2-5% in men, and 10-13% in women. The healthy range of body fat for men is typically defined as 8-19%, while the healthy range for women is 21-33%.

Sylvester is dealing with hearing loss. The doctor informs him that his basilar membrane is damaged. What type of hearing loss is Sylvester experiencing

Answers

Cochlear Hearing Loss

Explanation:

It is the main organ of hearing and is part of your inner ear. Cochlear Damage means that all or part of your inner ear has been hurt. Damage to the cochlea typically causes permanent hearing loss. This is called sensorineural hearing loss. More commonly know as: SNHL

What is the cause of the Carona Virus?
Or is the cause unknown.

Answers

The reason we have the Corona Virus is because some huh decided to eat a bat for some reason.

Answer:

Hi. Im just taking these points.

Explanation:

how do I make a homemade bandaid ​

Answers

Answer:

Put a paper Towel down and tape it

Explanation:

Don’t be a real man, that is my answer

How do blood types react in a transfusión ?

Answers

Answer:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Explanation:

person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.

Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :

Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :


PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)

Answers

Answer:

i put an answer but someone deleted it

Explanation:

HELP PLEASE
Which would bring out the details in a tire track in mud?
A)casting an impression with dental stone
B)burning magnesium ribbon
C)casting an impression with putty
D)photography with direct lighting

Answers

i believe the answer is D. it seems like the most reasonable one

The correct option is D) photography with direct lighting because it clearly shows the path and details of the tiretrack.

Tire marks can be seen on snow, mud, soil, sand, and even victims of crime scenes. These traces can be collected by photographing, pouring, lifting, and collecting the victim's clothing.

What is evidence of the pattern?

Tire marks are classified as evidence of the pattern, as tire marks leave a unique pattern. Just as shoe marks help narrow down brands, styles and sizes so can tire trucks.

Thus it clearly concludes that photography with direct lighting can collect great evidence.

To know more about tire track evidence refer to the link :

https://brainly.com/question/13397634

What is the function of the serous membrane? (Be specific about what types of body cavities)

Answers

To transfer semen from the uterus to the finger nails

Answer:

Serous membranes line and enclose several body cavities, known as serous cavities, where they secrete a lubricating fluid which reduces friction from muscle movement. Serosa is entirely different from the adventitia, a connective tissue layer which binds together structures rather than reducing friction between them.

Explanation:

BRAINLIEST PLZZZZZZ

which is the earliest school of medicine known to mankind??​

Answers

ayurveda. this type of medicine study originated in the early years in asia

16. The use of an electronic signature needs to be in compliance with
ОНІРАА.
O AMA.
Ostate laws.
O HEDIS.

Answers

Maybe state laws since your signature is on your identification? Not sure.

Solve: -3x+1<-5
X>
X> 2
4
x<-2

Answers

The answer is X>2 :))
Other Questions
write the neutralization equations that take place in the stomach with the bases present in the antacid product What type of tissue accounts for the crunch when you eat celery? Rachel likes the architecture of her friend's apartment and wants to capture it in a photograph for her portfolio. She wants the room to retain its identity. Which practice would be appropriate for Rachel to achieve this?A. use artificial light for the cameraB. use the natural light in the roomC. align the tripod to eye-levelD. clear the room of all accessories you did not make a mistakes. (affirmative) You can use the curved part of a spoon as a mirror because itlight.Which best completes the statement?O reflectsO refractsO absorbsO enhances bill nye chemical reactions: the picture looks cut off but can someone please help! [100 points! Please, I need the right answer!!]The length of a 2-inch-long thorn was measured by Sandrine to be 1.9 inches long. Which measurement is more precise but less accurate than Sandrines?1.95 inches2 inches2.12 inches3 inches HELPPPP PLEASEEEEEEAlthough scholars debate the exact numbers, in Alvin Josephy's estimate, the Indian population fell from between fifteen and twenty million when the white man first arrived to a fraction of that 150 years later. Undoubtedly the Indians perished in great numbers. Yet although European enslavement of Indians and the Spanish forced labor system extracted a heavy toll in lives, the vast majority of Indian casualties occurred not as a result of hard labor or deliberate destruction but because of contagious diseases that the Europeans transmitted to the Indians. The spread of infection and unhealthy patterns of behavior was also reciprocal. From the Indians the Europeans contracted syphilis. The Indians also taught the white man about tobacco and cocaine, which would extract an incalculable human toll over the next several centuries. The Europeans, for their part, gave the Indians measles and smallpox. (Recent research has shown that tuberculosis predated the European arrival in the new world.) Since the Indians had not developed any resistance or immunity to these unfamiliar ailments, they perished in catastrophic numbers.-- From The Crimes of Christopher Columbus by Dinesh D'Souza, 1995The author of this article believes that the Native American population declined greatly mostly because of A.enslavement, mistreatment, and hard labor.B.lack of immunity to some diseases.C.violent conflict.D.unhealthy patterns of behavior. Optimus Prime is flying straight up at 24 m/s when he accidentally drops his mega-ray blaster and it falls 94 m to the ground below. Calculate how long it takes for his mega-ray blaster to hit the ground. I NEED AN ANSWER ASAPThe distance between two cities on a map is 4 1/2 inches. The actual distance between the two cities is 24 miles.What is the scale used on the map?If the scale on a different map of the same area is 1/4 inch = 1 mile, how many inches separate the same two cities?HelperJan 13, 2020the scale is 4.5in/24misince 1 mile = 63360 in, that means the scale is4.5 : 24*63360 = 4.5 : 1520640 = 1:337920Maybe now you can figure the scale on the 2nd map.oobleckJan 13, 2020Thank You, SO MUCH!but can you answer the second question?HelperJan 13, 2020if 1 mile = 1/4 inch, then 24 miles = 24 times that in inches.PsyDAGJan 13, 2020huh. I guess you can't follow the logic? If 1/4 inch = 1 mile then the scale is1/4 in : 63360 inin = 1/4 : 63360now just simplify that so it is 1 : ____oobleckJan 13, 20206 inches is the second answerHelperJan 13, 2020Respond to this QuestionFirst NameYour ResponseSimilar QuestionsmathThe distance between Milltown and Summerville is 3.5 inches on a map. If the map scale is 1 inch = 20 miles, what is the actual distance between the towns? So 3.5*20=70. If it's 70 then it's in miles?maps and scale drawings math MATH HELP help !!!!the actual distance between two cities is 135 km. The map scale is 1 cm : 100 km find the map distance. A)13.5 cm B)1.35 cm C)0.135 cm D)1350 cmmath(CHECK ASNWERS)PLEASE CHECK MY ANWERS THANKS 1.The length of the driveway shown on a blueprint is 2 inches. If the actual length of the driveway is 20 feet, what is the scale of the blueprint? 1 in. = 1 ft 1 in. = 2 ft 1 in. = 10 ft (I PICK mathThe scale of a map is 1:250000.The actual distance between two cities is 80 km. Calculate this distance on the map. Give your answer in centimetreMath1.The actual distance between two cities is 135 km the map scale is 1 cm:100 km. Find the map distance. A)13.5 B)1.35////My answer//// C)0.135 D)1350 2. On a map of New Mexico, 1 cm represents 45 km. The distance from Albuquerque mathhey everyone can you guys please answer these 5 questions or 3 or 2 how many you want to answer I just need answers for these last 5 since I did the rest and thanks to you all because I do appreciate this. 1.The length of the mathThe scale on a map of the United States is 1 cm = 40 mi. If the distance between Albany, NY, and Chicago, IL, on the map is 21 cm, what is the actual distance between the cities? A. 840 miles B. 804 miles C. 800 miles D. 840 cm maththe distance between spice island and Kay island is 3.4 inches on a map if the scale on a map is 1inch=25 miles what is the actual distance between the 2 islands? A. 28.4 miles B. 75 miles C. 85 miles D. 850 milesMathYou are looking at a map with a scale of 1 inch equals 50 miles. If two towns are separated on the map by 8 inches, what is the actual distance between them?MathThe distance between Mountain View and crown top is 6.5 inches on a map if the scale on the map is 1 inch equals 25 miles what is the actual distance between the two towns 831.5 miles be 16.5 miles see 162.5 miles D 1 165 milesmathScale Drawings Marking City is 5 inches away from jamming city on the map. What is the actual distance between the two cities? Scale: 2inches:35Miles My answer 2in/35mi = 7ft/x mi 2x=7x35 2x/2=245/2 x=122.5 milesMathA map of Alberta has a scale of 1:1 500 000. On the map, the distance between Calgary and Banff is 2 5/8 inches. What is the distance between these two cities to the nearest mile?and don't say id k and take my points Could somebody pls help me with this question A figure has been dilated from the origin by a scale factor of one seventh. if another dilation from the origin maps the dilated image backonto the original figure, what is its scale factor? ?????????????????????????????? Robin saves $500 at a yearly simple interest rate of 4%. What is the total amount of money she has after 20 years? The ChrysanthemumsIn what ways is the tinker a contrast to Elisa? What might he represent for her? Is he sincere, or is he just a con man? Are there any ways in which they are alike? (Study their conversation carefully for clues, providing details in your response.) the earth's crust is part of which sphere? List two examples of how the land can have a dramatic change in temperature throughout the day. What is radioactive dating? How is it used to determine age of something?answer 2 question basically please Help!!! Who held the power in the system of sharecropping in the South?O White landowners held the power because they controlled the property. money, and supplies.O African American sharecroppers held the power because they outnumbered the white landowners.O White landowners and African American sharecroppers shared power because they both needed each other.O African American sharecroppers held the power because they occupied most of the land. which fatcor influence how people define their personal body image