what is the all year round climate present in the philipines

Answers

Answer 1

The average year-round temperature measured from all the weather stations in the Philippines, except Baguio, is 26.6 °C (79.9 °F). Cooler days are usually felt in the month of January with temperature averaging at 25.5 °C (77.9 °F) and the warmest days, in the month of May with a mean of 28.3 °C (82.9 °F).


Related Questions

I have no clue and the internet doenst help

Answers

Answer:

Soda

Explanation:

These are some weird questions...

I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.

what is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide

Answers

Nucleotide is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide.

What is anatomy?

Simple answer please!
I'll give brainlist

Answers

Answer:

Anatomy is the study of the bodies of people and other animals

hope this helps

have a good day :)

Explanation:

Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.

Compare photosynthesis and cellular respiration. In what types of cells do these processes occur?

Answers

Answer:

Cellular respiration occurs in both plants and animals.

But photosynthesis occurs only in plants. But photosynthesis can happen to 4 animals. It is only an exception, however. Sea slug and pea aphid may perform photosynthesis, oriental hornet, spotted salamander.

Explanation:

ATP is the main energy source of the cell. The most important final product of cellular respiration.

       The two main final photosynthesis products are glucose and oxygen.

Some of the cellular respiration enzyme reactions occur in the cytoplasm but the bulk is in the mitochondria. Inside the chloroplast, photosynthesis occurs.NADH is the high-energy cellular respiration electron carrier, while NADPH is photosynthesized as a powerful electron carrier.

In the cell chloroplasts, photosynthesis is carried out. This process gives energy directly or indirectly to all living organisms. Life on Earth would be no longer there without it.

Although photosynthesis needs energy and produces food, cellular breathing breaks food down and releases energy. Photosynthesis and respiration are carried out by plants while animals can only breathe.

2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration

Answers

Answer:

A . the formation of male and female sex cell is known as gametogenesis

the answer is a (gametogenesis)

Nancy visits a local reservoir where she feeds ducks and other birds. Every time she feeds them she notices that they fight for the best pieces and some do not get any. All living things struggle to get the necessary amount of food, water, and shelter. What is the term for this struggle?

A. overproduction
B. natural selection
C. variation
D. competition

Answers

i think its competition

Pls help this is due today

Answers

Answer:

scientific method can help resolve problems logically

Answer:

b. scientific

Explanation:

the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.

hope this helps! lemme know if you need more

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

Can someone pls answer these multiple-choice questions, will mark as brainliest.

Answers

Awnser b is correct

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

The similarity of the structures shown in the picture suggests that the organisms_______

1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly

Answers

1 because they all had traits that had come form somthing

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.

In your own words, can you explain where a hot
spot can be found AND what does it looks like?

Answers

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

Those who argue that objectivity is impossible are known as activitists.
O True
O False
ASAP
AND THANK YOU

Answers

The answer is true hope this helps

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

Which student provides the best explanation of how to determine whether Cell A or Cell B is a plant or animal cell? Rusty- "cell A is an animal cell because it contains more organelles than a plant cell, Cell B" Kristin- "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell" Darryl- " Cell B is an animal cell because it has nucleus" Eleanor- " Cell B is a plant cell because is has a larger cytoplasm then cell A which stores a plants water and minerals."

Answers

Answer:

Kristin's answer is the best.

Explanation:

It is the only correct answer.

The student that best explains whether Cell A or Cell B is a plant or animal cell is Kristin who said that "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell".

Distinctive features of plant and animal cells

Cell is the structural and functional unit of the living organism which contains organelles that carry out specific functions.

The plant cells can be distinguished from an animal cell through the following features:

it possess a larger vacuole which is centrally placed and helps in the storage of cell wastes.

It possess cellulose cell wall that provides support and structure to the cell.

They also possess chloroplasts which are not seen on animals cells.

Therefore, the student that best explains whether Cell A or Cell B is a plant or animal cell is Kristin who said that "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell".

Learn more about cells structure here:

https://brainly.com/question/6350862

Investiga un uso beneficioso (medicina o industrial) para las bacterias, virus y Hongos microscópicos. Explica brevemente su utilización.

Answers

Answer:

- Hongos: antibiótico penicilina

- Bacterias: producción de insulina para uso humano

- Virus: vectores basados en adenovirus para el desarrollo de vacunas  

Explanation:

Los microorganismos son fundamentales para el desarrollo de diferentes tipos de aplicaciones industriales y medicinales. Por ejemplo, la penicilina es una sustancia sintetizada por el hongo Penicillium notatum, la cual es ampliamente utilizada como antibiótico debido a sus propiedades antibacterianas. Las penicilinas son antibióticos del grupo de los betalactámicos que tienen como núcleo un anillo central de beta-lactama, las cuales son capaces de destruir una amplia variedad de bacterias​. Por otra parte, las bacterias pueden ser usadas para la generación de moléculas orgánicas con fines médicos. Por ejemplo, cepas de Escherichia coli han sido modificadas mediante técnicas de ingeniería genética con el objetivo de producir insulina humana, una hormona central en el metabolismo de la glucosa. Mediante técnicas de recombinación genética, el gen responsable por sintetizar insulina humana ha sido introducido en bacterias. Las cepas de E. coli son relativamente fáciles de cultivar en el laboratorio y por lo tanto permiten obtener grandes cantidades de esta hormona (insulina). Finalmente, existen ciertas tipos de virus inocuos para nuestro organismo los cuales han sido recientemente utilizados como vectores para el desarrollo vacunas. Mediante esta técnica de ingeniería genética, un determinado vector viral (por ejemplo, un virus de la familia de los adenovirus) es modificado genéticamente con el objetivo de insertar un fragmento de un agente infeccioso o 'antígeno' el cual individualmente es incapaz de producir daño. Las vacunas diseñadas a partir de vectores virales son inofensivas para el organismo pero son capaces de desencadenar una respuesta inmune contra el antígeno recombinante, generando de este modo una memoria inmunitaria en contra el agente infeccioso.

Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.


excluded from work

allowed to continue her duties as long as she does not start to feel worse

reported to the health department

restricted from working with food

Answers

Excluded from work because there’s risk of getting someone else sick and I think cross contamination

helpp mee pleaseeee need help

Answers

Answer: it will increase the frequency of the action potential hope this helps

Explanation:

Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane

Answers

Answer:

moving across both the plasma membrane and the outer membrane

Explanation:

Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.

this part too #stresscrying

Answers

Explanation:

It could be that both the parents were heterozygous, meaning having a dominant and recessive allele for example Aa..after these are paired you would see that they will form a white fur offspring.

Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?

Answers

Answer:

Do a literature search to find natural history information on closely related species.

Explanation:

In the context,  few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.

They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.

what are the four primary uses or benefits of the nguni breed amongst South African communities?​

Answers

Answer:

Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.

Explanation:


Which features form along all types of plate boundaries?
Hurry up!!

Answers

Explanation:

Ocean ridges features form along all types of plate boundaries.

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:

What is the main function of the central nervous system ? E2020

Answers

Answer:

The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation:

Answer:

Main function-the interpreter of the environment and  control over body movement.

The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..

If a plant develops a toxin, how
might a herbivore evolve in
response?
A. The herbivore will most likely change its diet.
B. The herbivore will eat the plant until it
becomes immune.
C. The herbivore will gradually evolve a
resistance.

Answers

Answer:

a

Explanation:

It will probably change it's diet

Answer: A the herivabore will change its diet unless the plant in question is a fundamental key to its survival that C the herbivore will gradually evolve a resistance but the answer would be A as this is not explained in the question.

which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes

Answers

C asexual reproduction

Which statement is true about gene expression? Give brainlist is answer right

Cells become specialized because different cells contain different sets of genes

Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used

A cell becomes specialized by controlling the which proteins are produced from the cell's DNA

Answers

Answer:

I guess All of them

Explanation:

Gene expression has all of these statements as given above in text.

Other Questions
A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area. what is the range of 20,15,10,5 Find the approximate surface-area-to-volume ratio of a bowling ball with a radius of 5 inches.A 0.6B. 0.67C. 1.67D. 25 A bakery celebrated its 25th anniversarylast Friday. On that day, every 12thcustomer received a free loaf of breadand every 9th customer received a freecupcake.Lauren was the first customer to receivea free loaf of bread and a free cupcake. What was Lauren's number? please help with the steps How would I figure this out? Segn Demcrito filsofo pre socrtico nos dice que el principio o Arj es el tomo, nos dice el orden de la naturaleza es helpppp plzzz helllpppp...and give steps plzz 5.Name three factors that may affect the carrying capacity of the population. (3 points) PLEASE HELP I NEED IT REALLY FAST!!!! Find a company offering different products and discuss what the company did to retain its customers under particular circumstances. Write an equation of the line that passes through the points (3.2) and (6,11). Show your work! Drag each tile to the correct box.Place the following events from modern Indian history in chronological order.TilesIndira Gandhielected primeminister ofIndiaIndira GandhiassassinatedSikh conflict atthe GoldenTemplepopulationreachesone billionJawaharlal Nehruelected primeminister of IndiaSequence