What is the maximum possible value of num after the code has been run?

What Is The Maximum Possible Value Of Num After The Code Has Been Run?

Answers

Answer 1

Answer:

the maximum value from the first line is 20 - 0 = 20

and from the second 20-5 and 20+5 so the maximum is 25


Related Questions

Help to draw in turtle. Python

Answers

Answer:

a basic piece of code:

from turtle import *

color('red', 'yellow')

begin_fill()

while True:

   forward(200)

   left(170)

   if abs(pos()) < 1:

       break

end_fill()

done()

Explanation:

What its doing is The TurtleScreen class defines graphics windows as a playground for the drawing turtles. Its constructor needs a tkinter.Canvas or a ScrolledCanvas as argument. It should be used when turtle is used as part of some application.

The function Screen() returns a singleton object of a TurtleScreen subclass. This function should be used when turtle is used as a standalone tool for doing graphics. As a singleton object, inheriting from its class is not possible.

All methods of TurtleScreen/Screen also exist as functions, i.e. as part of the procedure-oriented interface.

RawTurtle (alias: RawPen) defines Turtle objects which draw on a TurtleScreen. Its constructor needs a Canvas, ScrolledCanvas or TurtleScreen as argument, so the RawTurtle objects know where to draw.

Derived from RawTurtle is the subclass Turtle (alias: Pen), which draws on “the” Screen instance which is automatically created, if not already present.

All methods of RawTurtle/Turtle also exist as functions, i.e. part of the procedure-oriented interface.

You arrive at school on Friday for a field trip ! What a lucky day!You need to figure out what room you are in before leaving. You notice there are rosters on each door . What do you do to find your correct room?
If the roster were sorted alphabetically by last name , would that change how you found your correct room ?

Answers

Answer:

Look for the first letter of your last name

Explanation:

please answer ASAP!!!!!!

Answers

Answer:

the first constructor invocation will work.

pet temp("mouse", 5.99);

Explanation:

This will create a pet object on the stack, using the constructor.

If you want to create an object on the heap, you would use the new operator:

pet* pTemp = new pet("mouse", 5.99);

- What is the use of border? Differentiate between changing color of cells and color of data class 6​

Answers

Conditional formatting makes it easy to highlight interesting cells or ranges of cells, emphasize unusual values, and visualize data by using data bars, color scales, and icon sets that correspond to specific variations in the data.

A conditional format changes the appearance of cells on the basis of conditions that you specify. If the conditions are true, the cell range is formatted; if the conditions are false, the cell range is not formatted. There are many built-in conditions, and you can also create your own (including by using a formula that evaluates.

Which of these would be the best way to inform an employee that they are losing their job?
Group of answer choices

group email

face-to-face conversation

instant message

personal email

Answers

Answer:

Terminations are a sensitive subject.

Even if you have strong reasons for letting an employee go, sitting them down to explain they are out of a job can be an awkward conversation.  

Some employers might be tempted to fire an employee using an impersonal method ⁠— like a phone call, email, or text ⁠— just to avoid that discomfort. But that is a very bad idea. We strongly recommend that employers should only fire staff during a face-to-face termination meeting.

Write any two uses of ruler in word program

Answers

Answer:

1.It is used for draw the table, making results and assignments etc.

2.It is used for lining

Explanation:

Hope it helps

#CARRYONLEARNING

what is the hack of the cookie clicker

Answers

Answer:

Open Sesame

New Pokemon Games - The Loop. Open Sesame is the control panel for Cookie Clicker. It can be opened with a console command, or by changing the name of your bakery.

Explanation:

Hope this helps you !!

Hacking is a process to exploit a computer network system or a private network within a computer. Simply put, unauthorised access to or control of a computer network security system for unauthorised purposes.

To better explain hacking, we must first understand hackers. It’s easy to a Hacking assume that they are intelligent and highly skilled with computers.

In fact, breaking security systems requires more intelligence and expertise than actually creating them. There are no hard and fast rules that can classify hackers into neat categories. However, in common computer terminology, these are called white hats, black hats, and gray hats. White hat experts audit their own security systems to make them more resistant to hacking.

Learn more about network system here:

brainly.com/question/23294592

#SPJ6

Arrange the code so that the numbers are swapped.

Answers

Rand.int(your_num , your_num

A bulb has a resistance of 15Ω and is rated at 3A. What is the maximum voltage that can be applied across the bulb?

Answers

Answer:Wheres the option choice??????????????????????

Explanation:

Complete a flowchart and a Python program to calculate grade of a student based on marks using the following criteria:

Ask a student for their marks and if their marks are:

More than 90 – print “A*”

Between 80 and 90 – print “A”

Between 70 and 80 – print “B”

Between 60 and 70 – print “C”

Between 50 and 60 – print “D”

Between 40 and 50 – print “E”

Under 40 – print “Fail”

Answers

Answer:

grade = int(input("Enter grade: ")

if grade > 90:

   print("A*")

elif grade > 80 and grade < 90:

   print("A")

elif grade > 70 and grade < 80:

   print("B")

elif grade > 60 and grade < 70:

   print("C")

elif grade > 40 and grade < 50:

   print("E")

else:

   print("Fail")

Explanation:

What does an arrow after a command indicate

Answers

Answer:

the command still has to be carried out.

The arrows are an interactive continuation prompt. If you enter an unfinished command, the SQL shell (invoked by the mysql command) is waiting for the rest of it.

why is color important for all objects drawn ?​

Answers

Technically, drawing in colored pencil is simply layering semitransparent colors on paper to create vivid paintings. Every color has three qualities

Software that is used to detect and eliminate computer viruses. Question 3 options: Wi-Fi Cable Internet Antivirus Application Browser

Answers

Answer:

Anti Virus

Explanation:

Antiviruses (Windows Defender, McAfee, Avast) scan your computer/device for viruses.

In the program below, which two variables have the same scope?

def usernameMaker (strFirst, strLast):
return strFirst + strLast[0]

def passwordMaker (strA, numC):
answer = dogName[0:3]
return answer + str(numC)

# the main part of your program that calls the function
username = usernameMaker ('Chris', 'Smith')
dogName = 'Sammy'
favoriteNumber = 7
password = passwordMaker (dogName,favoriteNumber)

strA and

Answers

Answer: numC

Explanation:

strLast and strFirst have their scope up to the function usernameMaker only. They don't have any relation with the variable strA in terms of scope.

numC has the scope same as the variable strA. They both have scope in the function passwordMaker

Therefore, correct answer is numC

Answer: num C

Explanation: got it right on edgen

Computers were originally developed to accomplish various tasks in relative isolation, very different from the collaboration and communication we see today.

A.
True

B.
False

Answers

The answer is A, they were built for work.

You've just received an email message that indicates a new serious malicious code threat is spreading across the internet. The message contains detailed information about the threat, its source code, and the damage it can inflict. The message states that you can easily detect whether or not you have already been a victim of this threat by the presence of three files in the \Windows\System32 folder. As a countermeasure, the message suggests that you delete these three files from your system to prevent the code from spreading further.

Required:
Based on the email message, what are the next BEST actions to complete?

Answers

Answer:

The next BEST actions to complete could either be to call 911 or just drive somewhere further from your computer and where you live because the threat might come to your place, or it might already be in your place.

Explanation:

How to recover permanently deleted photos from gallery?

Answers

Answer:

it's technically impossible to recover permanently deleted photos

but if you have a copy of the photo or maybe have backup that would help.

I'm sorry if my answer isn't much help

what is a saved link to a particular web page?​

Answers

Answer:

A bookmark

Explanation:

A bookmark is a saved link to a particular Web page. Microsoft Internet Explorer denotes bookmarks as “favourites.” Boolean operators Most search engines (e.g. Go.ogle) allow you to limit your search or make it more specific by using words such as “and”, “or” and “not”.

One of the Windows workstations you manage has four user accounts defined on it. Two of the users are limited users while the third (your account) is an administrative user. The fourth account is the Guest user account, which has been enabled to allow management employees convenient workstation access. Each limited and administrative user has been assigned a strong password. File and folder permissions have been assigned to prevent users from accessing each other's files. Autorun has been disabled on the system.

Required:
What actions is MOST likely to increase the security of this system?

Answers

Answer:

All users on a Windows workstation are limited users except for one user who is responsible for maintaining the system.Explanation:

in reference to operating systems, what is spooling? what does it stand for? chegg

Answers

Answer:

Spooling is a process in which data is temporarily held to be used and executed by a device, program or the system. Data is sent to and stored in memory or other volatile storage until the program or computer requests it for execution. "Spool" is technically an acronym for simultaneous peripheral operations online.

Match each type of Save option on the left with a function on the right.

Answers

Answer:

the above is correct

Explanation:

relevez le rôle principal de la peau dans l,organime humain. je suis bloquée aidez moi metci​

Answers

Answer:

language?

Explanation:

Which of the following is Tynker an example of?
Group of answer choices

database

flowchart

Integrated Development Environment

binary code

Answers

Answer:\

Integrated Development Environment

hope it help

Answer:

C

Explanation:

i did the test

many phone fraud scammers are expessily cunning because they approach the target to try to sell

Answers

Answer:

improved computer security programs

Explanation:

Answer:

Improved computer security programs.

Explanation:

Just took the quiz

Sampson runs his own online business, and much of his success depends on the reliability and accuracy of various online data. How does integrity help to ensure that Sampson can trust the online data he is using?

A.
Integrity takes steps to ensure Sampson's information cannot be altered or deleted by unauthorized people.

B.
Integrity refers to a process that makes it impossible for anyone but Sampson to see the data that he is using.

C.
Integrity blocks all hackers from interfering with Sampson's data and what he does with it.

D.
Integrity allows Sampson to access and move data on an unsecured network.

Answers

Answer: because integrity takes steps to ensure Sampson's information cannot be altered or deleted by unauthorized people and that it stays intact, no matter where it goes

Explanation:

What type of information is appropriate for headers and footers? Check all that apply.

Answers

Answer:

C,  E,F,G  are correct

Explanation:

Answer:

C,E,F,G  are correct.

Explanation:

This program is an example of:

def factorial(x):

if x == 1:

return x

else:

return x * factorial(x-1)

Group of answer choices

a do while loop.

recursion.

a for loop.

a while loop.

Answers

The program is an example of recursion

In computer programming, recursion is a process in which a function calls itself.

In a recursive program, there is a

base case and a recursive case.

When the condition of recursion is met, the base case is returned, else, the recursive case is continued.

In the function given above,

the base case is 'return x' under the condition 'if x == 1'. The recursive case is 'return x * factorial(x - 1)'.

So, the function runs until the base case it met and then it stops.

So, the program is an example of recursion.

Learn more about recursion here:

https://brainly.com/question/25797503

Michaela has been tracking the temperatures of the dirt, pond water, and air near her home for a science investigation. She is ready to analyze the data to prepare for her science report. Based on each application’s strengths and weaknesses, which one would be the best to choose for this task?

Answers

Answer:

The science of investigation

Explanation:

hope it help

where deep convolutional neural network is used in real life

Answers

Answer:

Business applications of Convolutional Neural Networks. Image Classification - Search Engines, Recommender Systems, Social Media. Face Recognition Applications of RNN is Social Media, Identification procedures, Surveillance. Legal, Banking, Insurance, Document digitization - Optical Character Recognition.

goal of any user-friendly game should be to create a good what for the player?
A. user experience (UX)
B. user-interface (UI)
C. user intuition (UIT)
D. user skill (US)

Answers

Answer:

A

Explanation:

The goal of user friendly game is to provide UX.

For example a user friendly game will have much different interface than professional CAD program.

Answer:

user friendly.

Explanation:

Other Questions
Lyssa and Carlos own a hardware store. They sell a certain type of light bulb in packages that each contain 24 bulbs. The back of each package says, " The expected number of broken or defective packages per bulb is 0.25" Lyssa says, "If we look at 100 packages, we expect to see a total of about 250 broken or defectve bulbs" Carlos says, "Any given package most likely contains 0.25 broken or defective bulbs".Which Statement is correct based on the expected value?A. Only LyssaB. Only CarlosC. Both Statements are correct. D. Neither Statement is correct. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children....