What is the measure of A?
А [?] degrees
B 87
C 35

What Is The Measure Of A? [?] DegreesB 87C 35

Answers

Answer 1

Answer:

B 87

Step-by-step explanation:

Answer 2

Answer: 58

explanation: Acellus


Related Questions

Please solve and show your work. Thank you! I will mark brainiest :)

Answers

Answer:

x=22.5

Step-by-step explanation:

Make a ratio

The names of the triangle help with this.

AB is similar to FG, and AC is similar to FH (the missing side)

6/15 = 9/x

cross multiply

6x=135

divide both sides by 6

x=22.5

Answer:

X=22.5

Step-by-step explanation:

6/9=15/x

135=6x

22.5=X

The population of New York City is 23,945. Eastdale has a population of 12,774 What is the total population of the two communities
A.35,719
B. 36,619
C. 36,719
D. 37,619​

Answers

No.d
37,619

I hope that this helps you and please mark me as the brainliest.

Solve using substitution. You MUST find both variables to be crowned brainiest

2x + 4y = 40
x - 6y = -36

Answers

2x+4y=40
x=-36+6y
2(-36+6y)+4y=40
y=7
x=-36+6x7
x=6
(x,y)=(6,7)
2x6+4x7=40
6-6x7=-36
40=40
-36=-36
(x,y)=(6,7)

Which is equivalent to the series shown?
12
Which expansion is equivalent to the summation
shown?
12
12
20 Σ
1
n=9 n=9
n +
n=9
X
1 1 1 1
20+9+10+11+12+
9 10 11 12
-
Σ (20n +
+
Ź 201n+ )
20
n
n-9
x
1
1
-
1
11
1
12
20(9 + 10 +11+12) +.
9 10
2019 +10 +1
X
1 1 1
20 9+10 +11+12+
9 10 11 12
n +
n-9
12 12
1
12 + 20
n
n=9 n-9
12 12
1
n+
n-9 n=9n
1 1 1
9+10+11+12+ 20
9 10 11 12
20Σ
COMPLETE
Na
Intro
Final

Answers

Answer:

first one is (d) second one is (b)

Step-by-step explanation:

Please help Me ASAP Please

Answers

Answer:

217/31=7. He needs to run 7 miles per day.

Find the area. The figures are not drawn to scale.
12.
(1 point)
4 cm
6.9 cm
O 13.8 cm2
O 10.9 cm2
O 27.6 cm2
O 55.2 cm?

Answers

Answer and step-by-step explanation:

If it is a rectangle, the formula is:

L * W

Fill in the values:

4*6.9

Then solve.

27.6

So, if it is a rectangle, the answer is (C), 27.6 Inches squared.

If it is a triangle, the the formula is:

(B*H)/2

Fill in the values:

4*6.9/2

Simplify:

27.6/2

Then solve.

13.8

So, if it is a triangle, the answer is (A), 13.8 Inches squared

Hope this helps!

find the volume of the cone Diameter:10 m and Height:10m, round to the nearest whole number​

Answers

Answer:

und wey kennen diese Antwort oder Art und Weise nicht, wie Sie sie wahr übersetzt haben

Which statement is true?

Answers

Answer:

[tex] (\sqrt[m]{ {x}^{a} } ) ^{b } = \sqrt[m]{ {x}^{ab} } [/tex]

Find the probability that a randomly selected point within the white area r=4

Answers

Answer:

0.25

Step-by-step explanation:

Triangle AA'B'C' is the image of AABC under a rotation about point P.

Answers

dont click on the links its a scam

The length of a rectangle is 13 centimeters less than four times its width. Its area is 35 square
centimeters. Find the dimensions of the rectangle.
The width is
and the length is

Answers

Answer:

width 5

length 7

Step-by-step explanation:

W * L = 35

L = 4 * W - 13

W * (4W-13) = 35

4 W^2 - 13 W - 35 = 0

delta = 169 + 4*4*35 = 729 = 27^2

W = (13 + 27) / 8 = 5 (its the only solution since 13 - 27 is less than 0 which makes no sense)

L = 4 * 5 - 13 = 7

The length and width of the rectangle are 7 cm and 5 cm respectively.

What is a rectangle?

A rectangle is a closed 2-D shape, having 4 sides, 4 corners, and 4 right angles (90°). The opposite sides of a rectangle are equal and parallel.

Given that, the length of a rectangle is 13 cm less than four times its width. Its area is 35 cm².

We know that, the area of a rectangle = length × width

Let the width of the given rectangle be w,

According to question,

length = 4w - 13

Therefore,

(4w - 13) × w = 35

4w² - 13w = 35

4w² - 13w - 35 = 0

Factorizing, we get,

w = 5 and w = -7/4

Therefore, width = 5

Length = 20 - 13

Length = 7

Hence, the length and width of the rectangle are 7 cm and 5 cm respectively.

Learn more about rectangle, click;

https://brainly.com/question/29123947

#SPJ2

How do you balance these Chemical equations?

1.C+ ZnO= Zn+CO2
2.Pb+HCl=PbCl2+H2

Please show your work.

Answers

Answer:Zno C Zn co2

Step-by-step explanation:

C is a reducing agent, ZnO is an oxidizing agent. ; White, odorless solid.

The figure below is a scale drawing of a
rectangular ball room. The scale is 2 cm:4
m.
6 cm.
12 cm.
What is the area of the actual room?
A. 72 m²
B. 144 m2
C. 288 m
D. 576 m

Answers

Answer:

Area of the actual room = 288 m²

Step-by-step explanation:

Given:

Scale factor = 2cm to 4 m

Dimension of rectangle ball room = 6 cm and 12 cm

Find:

Area of the actual room

Computation:

Actual dimension of rectangle ball room;

⇒ [6/2]4 = 12 m

⇒ [12/2]4 = 24 m

Area of rectangle = Length x Width

⇒ Area of the actual room = Actual length x Actual width

⇒ Area of the actual room = 12 x 24

Area of the actual room = 288 m²

if t=2, what is √18t?

Answers

Answer:

s

Step-by-step explanation:

5.5~

Answer:

8.48528137 I think

Of the 31 teachers at Keenan's high school, 14 are female. What is the ratio of the number of female teachers to the number of male teachers?​

Answers

Answer:

The answer is 14:17

Step-by-step explanation:

31-14 is 17 and 14 are female and 17 are male so we do 14:17

159. Three percent size is the size

Answers

So to to get 3% of 159 you: 159x0.03=4.77

Which one is right can y help me

Answers

Answer:

What are you trying to find out? Like what do you mean by which one is right?

Step-by-step explanation:

What are the ordered pairs of the solutions for the
following system of equations?
(3, [?]); ([ ], [ ])

Answers

Answer:

(3,1) ; (6,-2)

Step-by-step explanation:

We have to search the points that the line and the parabola have in common, that are the points where they intercept

(3,1) ; (6,-2)

The product of two consecutive odd integers is 63. If x is the smallest of the integers, write an equation in terms of x that describes the situation, and then find all such pairs of integers.

The equation that describes the situation is __________________
The positive set of integers is _________________
The negative set of integers is _________________

Answers

9514 1404 393

Answer:

x(x+2) = 637, 9-9, -7

Step-by-step explanation:

If x is an odd integer, the next greater odd integer is x+2. The product is said to be 63, so the equation is ...

  x(x +2) = 63

__

The equation can be rewritten as ...

  (x +1)² = 64

  x = -1 ±√64 = -1 ±8

The positive solution is x=7, so the positive set of integers is {7, 9}.

The negative solution is x=-9, so the negative set of integers is {-9, -7}.

Solving a word problem on proportions using a unit rate
Alonzo drove 335 miles in 5 hours.
At the same rate, how long would it take him to drive 469 miles?

Answers

Answer:

7 hours

Explanation:

Divide 5 and 335 then multiply by 469

because 5 / 339 will be time for one mile and then multiply by 469 will be number of hours for 469 miles

5 / 339 × 469 =7 hours

It is felt that respondents are more likely to be honest when a randomized response survey is used. Subsequently, a substance-abuse prevention program at a university has designed and distributed the following questionnaire to all the employees and students: Flip a coin. If the coin comes up heads, answer Question a; if tails, answer Question b. All answers are anonymous. a. Do you carpool to the school

Answers

Answer:

hello your question is incomplete  below is the complete question

answer : 18%

Step-by-step explanation:

x = percentage using illicit drugs

sample size = 5000

number of persons with a yes = 1200

also management knows that 30% uses carpool

∴P ( yes ) = P( H and yes to carpool ) + P( T and yes to illicit drug use )

1200 / 5000 =  (0.5  * 0.3 ) + ( 0.5 * x )

 0.24 = 0.15 + 0.5 x

hence x ( percentage using illicit drug ) = ( 0.24 - 0.15) / 0.5 =  0.18 = 18%  

volume of a cylindrical can of juice is 500cm3 and the diameter of its base is 8 cm find the height of the can of pineapple juice

Answers

Answer:

Height = 2545.45cm

Step-by-step explanation:

Volume of cylinder = pie r^2 h

500 = 22/7*4*4*h

500*7/22*16 = h

2545.45cm = h

Find the total area: ​

Answers

Answer:

518 cm squared

Step-by-step explanation:

Answer:

518 cm²

Step-by-step explanation:

First, we can split the shape into two parts.

The first part will be 8+22(which is the width)x13(29-16, which is the height). This gives us:

30x13=390 cm²

Now, for the next part, we have 8(width)x16(height), which gives us:

8x16=128 cm²

Finally, we add 128+390=518cm²

For the data set shown in the scatterplot, what is the BEST approximation of the y-intercept for the line of best fit? A) 0 B) 50 C) 125 D)200​

Answers

Answer:

C) 125

Step-by-step explanation:

If you add a line of best fit, its extension is likely to intersect the y-axis between 200 and 100 but closer to 100.

The best estimate is choice C) 125

What is it i’m really really really confused about it lollll

Answers

Answer:

it would be D

So, when they say quantities that combine to make 0, that means you have to lose, and then gain the same amount back.

If you look at all the other choices, they either keep on gaining or they don't gain the same amount they lost

Think about it as breaking even.  You aren't actually gaining anything if you are gaining back the exact same amount you lost.


The radius of a cylindrical water tank is 4.5 ft, and its height is 8 ft. What is the volume of the tank?

Answers

Use the value 3.14 for it, and round your answer to the nearest whole number.
Be sure to include the correct unit in your answer.
15 . Mark me brainliest !!

If a certain roundabout has diameter of 96 feet,
about how far would a car travel if it drove once
around?
A. 150.8 feet
B. 301.6 feet
C. 348.5 feet
D. 7,238.2 feet

Answers

9514 1404 393

Answer:

  B.  301.6 ft

Step-by-step explanation:

The circumference of the circle is given by the formula ...

  C = πd

For a diameter of 96 ft, the circumference of the circle is ...

  C = π(96 ft) ≈ 301.593 ft

The car would travel about 301.6 feet.

Lines AB and XY are best described as which of the following?
A
BO
A. Perpendicular segments
B. Perpendicular rays
ОООО
C. Parallel lines
D. Perpendicular lines

Answers

Lines AB and XY best describe the perpendicular segments. The correct option is A.

What is a line segment?

A line segment in geometry is a section of a line that has two clearly defined endpoints and contains every point on the line that lies within its confines.

A coordinate plane is a 2D plane that is formed by the intersection of two perpendicular lines known as the x-axis and y-axis. A coordinate system in geometry is a method for determining the positions of the points by using one or more numbers or coordinates.

Lines AB and XY best describe the perpendicular segments. AS they are cutting each other at 90 degrees.

To know more about line segments follow

brainly.com/question/2437195

#SPJ1


Which equation shows the
commutative property of addition?
A 2x = 2x
B 2x + 3 = 3 + 2x
C 2x - 3 = 2(x - 3)
D 2(x + 3) = 2x + 6

Answers

Answer:

B

Step-by-step explanation:

Have a nice day!

The answer is B since you can add in any order with those numbers

bill,bob,and joe each have 9 oranges. Then a stranger gave Tim 4 oranges. He then gave 3 to his mother.​

Answers

1 orange
Hopefully this helped you out
Other Questions
Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by?