What is the name of the rabbit in frosty the snowman?

Answers

Answer 1

Answer:

Hocus Pocus.

Hope this helps❤

Answer 2
The answer to this question is Hocus Pocus

Related Questions

Teach is to instruct as___ is to refuse

Answers

Answer: Teach is to instruct as (deny / decline / reject ) is to refuse.

I wasn't sure which one to use so you can take your pic :')

We tried to ( convince- convert- appeal ) her that she should move to a smaller flat​

Answers

Answer:

correct answer is convince which means to persuade someone to do sth

How has the job market changed to cause the need for students to learn 21 stCentury Skills

Answers

Let’s take a loook back for instance technology has advanced. There are more remote jobs now than their was before. The economy does change living in the valley tub in the bay. I understand work wages are different having a degree pays more than no degree. Students are doing more work online than paper and pencil! The 21st century has changed significantly for the better to provide jobs with degree and skillls.

I know one place in the northern part of the state where I camped a while in the summer, and I went to the school and talked to the
teachers. They are using school books which have been passed down from one child to another. They have practically no books outside of
the textbooks. The children in the district are so poor and some of them so pathetic that I suppose the struggle to live has been so great you
could not think much about what you fed the mind, but I came away feeling that right there, in one of the biggest and richest states in the
country, we had a big area that needed books and needed libraries to help these schools in the education of the children, and, even more,
to help the whole community to learn to live through their minds.
We are doing a tremendous amount through the home economics colleges to help people to learn how to live in their homes, to better their
standards of material living. We have got to think in exactly the same way about helping them to live mentally and to attain better
standards, and we can do it only through the children. We can do ground work with the children; we must begin with them, but we have got
to do a tremendous amount with the older people.
What is one central idea of Roosevelt's writing?
ОА
ОВ.
the need for libraries in order to help improve people's overall quality of life
the need to educate parents and children about the value of books
the need to prioritize learning over other material concerns
the need for efforts that are focused on teaching children to read
Ос.
OD

Answers

Answer:

It's D) on my options: the need for libraries in order to help improve people's overall quality of life

Explanation:

Read the following excerpt from Eleanor Roosevelt’s speech “What Libraries Mean to the Nation.”

I know one place in the northern part of the state where I camped for a while in the summer, and I went to the school and talked to the teachers. They are using school books which have been passed down from one child to another. They have practically no books outside of the textbooks. The children in the district are so poor and some of them so pathetic that I suppose the struggle to live has been so great you could not think much about what you fed the mind, but I came away feeling that right there, in one of the biggest and richest states in the country, we had a big area that needed books and needed libraries to these schools in the education of the children, and, even more, to the whole community to learn to live through their minds.

We are doing a tremendous amount through the home economics colleges to people to learn how to live in their homes, to better their standards of material living. We have got to think in exactly the same way about ing them to live mentally and to attain better standards, and we can do it only through the children. We can do ground work with the children; we must begin with them; but we have got to do a tremendous amount with the older people.

What is one central idea of Roosevelt’s writing?

A.

the need to educate parents and children about the value of books

B.

the need to prioritize learning over other material concerns

C.

the need for efforts that are focused on teaching children to read

D.

the need for libraries in order to improve people’s overall quality of life

which event occurs as a direct result of pops tellling ted he wants t get rid of Ollly

Answers

When Ted claims he will have to get rid of Olly, Mrs. Saunders proposes to keep Olly if Ted helps her with the orchard.

We can arrive at this answer because:

Ted is very fond of Olly, a horse he has taken care of for a long time.However, he will need to withdraw from the horse's care because of his school obligations.His father claims he will have to get rid of Olly and Ted looks for someone who can keep the horse, but no one seems available.

However, when Ted tells Mrs. Saunders that he will have to get rid of the horse, she claims that she can keep the horse if Ted commits to helping her with the orchard three days a week.

That way he can continue to have contact with the horse and she will get help with the tasks she has.

This question is about "Ted’s Champion" where we can see the theme that taking care of animals is always rewarding.

More information on the theme of a text at the link:

https://brainly.com/question/4008478

What is the importance of confronting adversity?
Need two reasons
NEED ASAP PLSSSSSSS

Answers

Answer:

You can stand up to it only know 1 sry.

Explanation:

Identify the choice that best answers the question.
What is the best way to correct this sentence?
If toddlers like Anthony do not get his rest, he starts to get very irritable.
A. Change his to their and change he starts to they start.
B. Only change his to their.
O
C. Only change he starts to they start.
D. Change his to its and change he starts to they start.

Answers

Answer:

A: Change his to their and change he starts to they start.

Explanation:

"Their" is referring to the toddlers in general. Anthony is simply an example of A toddler, not ALL toddlers. Then, "they starts" refers to the toddlers since the sentence talks about the TODDLERS and NOT Anthony.

I want to now that is marked as brainlist mean​

Answers

Answer:

To marked as brainlist is to have the best answer possible for the questioner to understand. There would be two people who answers and if the questioner thinks one answer has a better answer and quality than the other one, the questioner can mark that answer as brainlist.

Explanation:

Hope this helps!

[tex]Hiya![/tex]

Sokka is here to help!!

Marked brainlist means that you got a good answers/explanation or they just marked brainlist.

Hopefully, this helps you!!

[tex]Sokka[/tex]

__________is the main point an author is attempting to prove in an essay.

reasoning


claim/thesis


evidence


hook

Answers

Claim/ thesis trust me

Answer the following questions based on the article you just read.
Name one advantage of light microscopes
over electron microscopes.

Answer:
Living cells can be observed using a light microscope; this is not possible with an electron microscope. Unlike electron microscopes, light microscopes allow scientists to observe changing movements in living cells.

Answers

Answer:

Living cells can be observed using a light microscope; this is not possible with an electron microscope. Unlike electron microscopes, light microscopes allow scientists to observe changing movements in living cells.

Explanation:

Explanation:

wrong answer ^^^ i got a 0% give me Brainliest thx

Answer:

Living cells can be observed using a light microscope; this is not possible with an electron microscope.

10.A: How was your trip to Vietnam after 10 years?
B:
a.Amazing! I couldn't believe how much it has changed!
b. Thank you for asking me.
c. 10 years? It's 11 years.
dNo, I can't tell you.

Answers

Answer:

amazing i couldn't believe how muchit has changed

The appropriate reply to the question asked will be A. Amazing! I couldn't believe how much it has changed!

It should be noted that in this situation, a question is asked and an appropriate answer is required. Therefore, one can't say thank you for asking me.

Therefore, the appropriate answer to the question "How was your trip to Vietnam after 10 years?* will be "Amazing! I couldn't believe how much it has changed!

Learn more about questions on:

https://brainly.com/question/24373788

TO KILL A MOCKING BIRD SINGLE PARAGRAPH HELP!

Answers

Look it up, just search up summarize and it’ll show

tìm lỗi sai trong 2 câu sau
1) I'm going to have my car repair next week
2)peolpe whom volunteer to work in asian countries spend up to six months at a time in the south of africa

Answers

1) I’m going to have my car repaired next week.
2) People who volunteer to work in Asian countries spend up to six months at a time in South of Africa.

( xin chào! hy vọng những điều này là chính xác! )

3. They love _______________ with their friends.

A. eat out

B. ate out

C. having eaten

D. to eat out

Answers

The answer is D
They love to eat out with their friends

Answer:

D.) to eat out

Sentence: They love to eat out with their friends.

What is an inference that can be made about Dr. Mesmer’s skill?

Answers

Franz Mesmer was a German doctor and he was interested in astronomy. The existence of the natural energy transference is theorised by Franz Mesmer. This term is also called as the animal magnetism. He has deduced the theory on the basis of many methodologies and the experiments which he has done on the patients individually and in groups. A series of experiments was conducted by him and the results were concluded on the basis of further investigations.

My mother asked, "What happened to your shoes?" Turn Into Indirect speech​

Answers

Answer: Mother said ," What happened to your shoes?"

Explanation:

the mother wants to know what her son or doughter has done to get there shoes like that

What does the umbrella look like after Gloria and Davis finish wrapping it?
Answer

Answers

Once wrapped, the umbrella looked like a giant diamond.

We can arrive at this answer because:

The boys agree that it is very difficult and awkward to wrap an umbrella.So they decide to wrap the umbrella in a fun way that is completely different from normal.With that, they gather all the pieces of wrapping paper and stay and start gluing them together in a completely random way.

In the end, the umbrella looks like a giant diamond, which makes everything much funnier.

This question is about "Wrapping Up A Little Bit of Trouble"

More information about gift wrapping at the link:

https://brainly.com/question/15476526

"Wrapping Up a Little Bit of Trouble" is known to be a story that was written by W.M. Akers. The wrapped umbrella was regarded as the  messiest present ever wrapped by them. They also stated that it may also be the best because it  resembles a five‐feet‐tall/ giant diamond

In the story, she emphasize that she did not know how to wrap it, but her Dad explained the process for her.

She tried at first but the umbrella pops  open in her face. Her Dad explained again on how to wrap the umbrella and told her to use up all the rest of  the wrapping paper and then still showing her the process.

She commented that it would look messy and hilarious but she still  followed his instructions. After they had used up the rest of the roll and part of the another one, no corners of the wrapped up umbrella was are tidy even no edges did line up.

The story is all about  two characters called Gloria (the narrator) and Davis (Gloria's brother). The conversation took place on December 20th of the year, which was near Christmas Day.

Learn more about other similar passage from

https://brainly.com/question/12809344

What does the phrase ""for the arrival of a ship is always a great event in Marseilles"" suggest about the town of Marseilles?

Answers

Answer:

he town looked forward to change and innovation.

Explanation:

What is Confidence??...................!!

Answers

Answer:

the feeling or belief that one can rely on someone or something; firm trust.

Answer:

Confidence is a state of being clear-headed either that a hypothesis or prediction is correct or that a chosen course of action is the best or most effective. Confidence comes from a Latin word 'fidere' which means "to trust"; therefore, having self-confidence is having trust in one's self  Explanation:

Which thesis statements are effective for an informative essay about developments in the English language? Check
all that apply.
The English language has changed due to the development of new technologies throughout history.
I believe that the English language should change to be more universal.
O Colonialism had a major effect on the development of the English language.
Shakespeare's important contributions to language should be celebrated by those who research language,
literature, and the arts.
Languages around the world are constantly changing for many reasons, but English is the only language
important enough to research.

Answers

Answer:

A). The English language has changed due to the development of new technologies throughout history.

C). Colonialism had a major effect on the development of the English language.

Explanation:

What is the saying fool me once, shame on you, fool me twice, shame on me fool me three times lyrics?

Answers

Answer:

ya i Hay twice

Explanation:

How might you use food labels to choose between two types of canned soup?

Answers

Checking the price and the amount of salt

a group of lines in poetry separated by spaces

Answers

Answer:

the answer is a Stanza.

Explanation:

stanzas




hope this helps you

Watch the film (into passive voice)​

Answers

Explanation:

A movie is going to be watched by us tonight.

Explanation:

we are watching the movie tonight

Literal Language, Figurative Language Allie has a million pairs of shoes in her closet​

Answers

Figurative Language, specifically a hyperbole. A hyperbole is a type of figurative language that uses an extreme exaggeration.

Good Luck :)

question 38 i’m stuck on

Answers

Explanation:

Federalist Paper 84 argued that the Constitution didn’t need one immediately, but amendments could be added later. Read more about the question “why do we need the Bill of Rights” and Federalist 84. Federalist 84 Addresses Objections. One of the primary objections to the Constitution was that it contained no bill of rights. The Federalist ...

What is katniss's reaction to Claudius Templesmith's announcement about the rule change? How does this change Katniss's plan for the Games? To ppl that have read the Hunger games

Answers

Answer:

Katniss's first reaction to the second rule change is to shoot Peeta when she sees his hand grabbing the knife. when she realizes that he does no intend to defend her she feels ashamed of her gut reaction to kill him. After that they agree to both eat poisonous berries so that they both die together.  

(hunger games, divergent, and the maze runner are my favorite book series btw)

She was very shocked more then hurt at first more of a sense of worry .

Can anyone help? (I agree with the statement)

Answers

Answer:

I agree with the statment

Explanation: it makes sense and also you are smart

What is the theme of “Journey” by Edna St. Vincent Millay?

Answers

'Journey' by Edna St. Vincent Millay describes a speaker's desire to live a life experienced on an open path, and filled with natural wonder. In the first section of the poem, the speaker admits her desire to leave the path of her life and take the time to relax in a field.

Which examples of propaganda are found in this passage? Select two options.
Snowball is used as a scapegoat.
Napoleon talks to the animals through Squealer.
Squealer targets his message to emphasize plain folks.
Squealer uses glittering generalities to describe Napoleon’s tactics.
Napoleon uses name-calling to differentiate the pigs from the other animals.

Answers

Answer:

Napoleon talks to the animals through Squealer and the Squealer uses glittering generalities to describe Napoleon’s tactics.

Explanation:

Answer:

maybe b and d

Explanation: I am taking the test

Other Questions
the origins of the atlantic slave trade were associated with the =Given f(x) = -3x 2 and g(x) = -2x - 4, find h(x) = g(x) f(x). What do you think Madison needs to include in the fire prevention training plan? Which statement best explains how the animals in the diagram contribute to the carbon cycle?AThey eat plants and other organisms that contain carbon which prevents it fromever being Stored.BThey eat plants and other organisms which contain carbon and deposit carboninto the soil when they die.They remove carbon from the atmosphere during respiration and replace it withoxygen that is used in photosynthesis.DThey remove carbon from the soil during respiration and exchange it withoxygen that evaporates into the atmosphere. Which of the following goals is NOT a focus of typical community health promotion efforts? A. Lower prescription costs B. Long-term health C. Disease prevention D. Senior citizen health Please select the best answer from the choices provided. A B C D. Lyssa and Carlos own a hardware store. They sell a certain type of light bulb in packages that each contain 24 bulbs. The back of each package says, " The expected number of broken or defective packages per bulb is 0.25" Lyssa says, "If we look at 100 packages, we expect to see a total of about 250 broken or defectve bulbs" Carlos says, "Any given package most likely contains 0.25 broken or defective bulbs".Which Statement is correct based on the expected value?A. Only LyssaB. Only CarlosC. Both Statements are correct. D. Neither Statement is correct. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. Who is Francois Mauriac and why, according to the Preface/Foreword, does he help Wieselget published? How does Mauriac describe Wiesel? Use textual evidence to support youranswer:I a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas