What is the origin of the word arthropod?

Answers

Answer 1

Answer:

Etymology

Explanation:

Answer 2
Etymology. The word arthropod comes from the Greek ἄρθρον árthron, "joint", and πούς pous (gen. podos (ποδός)), i.e. "foot" or "leg", which together mean "jointed leg".

Related Questions

Amino acids are small molecules that make up proteins.
What information do genes determine when building proteins?
Select all that apply.

1)the amino acids that are used.
2)the order of the amino acids.
3)the location where the protein is built.
4)the total number of amino acids.

Answers

2 and 4 should be correct
2 & 4 are correct i hope!

Select whether the description is for Vertebrates or Invertebrates.

insects, spiders, snails, and worms

most types of pets

more of them on Earth than the other group

have simpler body systems

have more-complex body systems

fish, birds, reptiles, amphibians, and mammals

Answers

1) invertebrate
2) vertebrae
3) vertebrae
4) invertebrate
5) vertebrae
6) vertebrae
The difference between Invertebrates is that they have no spine and vertebrates are those who have a spine.

For the first one, it is invertebrates
For the second one, it’s vertebrates
For the third one, I think it’s vertebrates
For the fourth one, invertebrates
For the fifth one, vertebrates
For the sixith one, it is vertebrates

Hope this helps!! Sorry if there are some typos

The best answer gets brainliest
Please help me answer these two questions
Why do you think certain cell types look the way they do? What do you think the relationship is between a cell’s structure and its function?
Please no links, thank you

Answers

I think that cell types look the way they do because they are all very unique. They don’t have much space to look a certain way but they are all unique in their own ways. The structure of a cell does have something to do with it’s function, it has to be small to do it’s work.

If i’m the best mark with crown please!

Answer:

i think they look like that so the prisoners are see able and cant do any thing to escape.because the guards are walking by twenty four seven

Explanation:

The picture below shows what type of energy?

A. Potential

B. Radiant

C. Thermal

D. Kinetic

Answers

thermal- everything releases heat
(sweat, fast motion, in the sun, hot temp etc..)


hope this helps

Answer:

Thermal

Explanation:

help please question in the photo below thx

Answers

The answer is b since it is the most red and if you look at a compass, it is southwest
B beacuse it is red

PLEASE HELP!!! PICTURED PROVIDED
Mabel read that heavy watering promotes growth in sunflower. She planted 6 plots of sunflowers with 5 plants each and watered each plot with a different amount of water. The table shows her results...

Answers

This picture is. It clear can you make it more clear the first answer is right make him brain list
can u re post this because its really hard to see the picture

Hey can somebody plz answer this two

Answers

Chloroplast I’m pretty sure
The Chloroplast is responsible

The condition of the environment has no effect on the people, animals, or plants that live in it.

Answers

Answer:

Assuming this is a true or false, it is False

Explanation:

Answer: bit is False

Can organisms grow in environments that do not meet their needs?

(Please be legit about the answer thank you)

Answers

Yes organism can grow in environments that do not meet their needs but it would be very hard for them to stay alive in that environment since it doesn’t have all the requirements the organism needs to survive.

Answer:

In most cases, no.

Explanation:

Some basic needs of an organism are an appropriate environment ( E.g. Having water for fishes, be it salty or fresh), have a reasonable temperature and pH value of its surroundings, and having enough food to sustain itself. You can even look at things like air composition.

There's no way an organism that normally lives in slightly alkaline water can survive in water with a pH of 3. Similarly, organisms can't survive in unsuitable temperatures, like how a polar bear can't survive in the desert.

In cases like food, they would die from starvation without appropriate amounts of food.

In essence, an organism is not likely to be able to grow in environments that do not meet their needs.

Some organisms adapt and change over time depending on the organisms, but most of them may die before adulthood.

Please help me :/ im not smart

Answers

Answer:

Well I'm not smart either. But i'll give you the answer.

Explanation:

Since the population of gray squirrels and brown squirrels decreased, and the population of black squirrels increased, that means the gray and brown squirrels were eaten/left and didn't blend in very well to their habitat. However, the population of black squirrels increased, so they blended in well with their environment. This tells us that the color of the trees became darker, closer to black, since there were more of them.

Answer: in explanation

Explanation:

Over time the color of the trees changed to black or a dark color. Because the color of the trees changed the gray and brown squirrels were more noticeable to the foxes causing them to be killed off. This meant over time the squirrells with black fur survived and bred eventually populating the area with black squirrells.

How is information passed between neurons in the body?
A. through impulses
B. through motor neurons
C. through interneurons
D. through sensory neurons​

Answers

Answer:

The place where the axon of one neuron meets the dendrite of another is called a synapse. Neurotransmitters travel across the synapse between the axon and the dendrite of the next neuron. Neurotransmitters bind to the membrane of the dendrite. The binding allows the nerve impulse to travel through the receiving neuron.

Explanation:

Answer:

D. sensory neurons

Can you please answer this i need your help Subject science

Answers

Answer:

the 3rd one and the last one

Explanation:

Answer:

the little plant

and the palm tree

Which diagram correctly portrays the direction of the prevailing winds in each latitude band? (look at the pictures)
A.
E.
B.
C.
D.

Answers

Your answer should be E and C

Option C and E are  the diagram which correctly portrays the direction of the prevailing winds in each latitude band

what is latitude?

Latitude and longitude are two most important terms which are the coordinates that, together, tells exactly location of an object on the surface of the Earth.

Latitude tells the position of the object or anything  between the North Pole and the South Pole where equator is zero degrees, the North Pole is 90 degrees North, and the South Pole is 90 degrees .

Parallels called as latitude lines which run across the Earth from east to west at a constant latitude, for example would be the equator, which is at zero degrees of latitude

Latitude is major indicator of navigation because the path of the sun is different depending on the object's latitude, so it varies based on the time of year.

For more details  latitude,  visit

https://brainly.com/question/13433484

#SPJ2

In a well-constructed paragraph, answer the question below.

What are two benefits of having a soft mostly hollow spongey part of our bones?

~Will give Brainliest if you give me a good paragraph and it's correct~

Answers

Answer:

The lamellae of spongy bone will form an open for the porous network of bony branches, or beams, called trabecula.

It also gives the bone strength and make the bone lighter. This also allows room for blood vessels and bone substance. Subscribe to amiredagoat Yt pls

Explanation:

Why does the moon appear to change its shape as seen from earth?

Answers

D.
Different parts of the sun lit moon become visible as the moon revolves around earth

This happens because as the moon orbits earth the sun will project light towards it and the reason it seems to glow is because of the reflected light since the moon is white it reflects more light. Think of it as a day and night cycle except it’s on the moon when it becomes night on earth the part of earth facing towards the sun will be lit aka day/morning/afternoon etc
The part of the earth facing away will be dark aka night/midnight/etc.
D because as the moon revokes it goes around earth to every state and it takes 12 hours in our time for it to get to us.

In a cell, a part of the DNA codes for a protein is damaged.
Which statement describes this situation?

1) the cell has the information but does not have the machinery to build the protein
2) the cell has the information but cannot carry it out of the nucleus
3) the cell has the information, but molecules that will make up the protein cannot enter the nucleus
4) the cell lacks the information to build the protein

Answers

I’m pretty sure it’s 3

Answer:

The correct answer is number 3)

Explanation:

Give examples of animals in the phylum arthropoda. What is their importance?

Answers

Answer:

Arthropods play an important role in maintaining the health of ecosystems, provide livelihoods and nutrition to human communities, and are important indicators of environmental change. Yet the population trends of several arthropods species show them to be in decline.

Explanation:

d

how are traits passed down from one generation to another

Answers

Answer:

Genes & DNA

Explanation:

Heritable traits are known to be passed from one generation to the next via DNA, a molecule that encodes genetic information.Organisms inherit genetic material from their parents in the form of homologous chromosomes, containing a unique combination of DNA sequences that code for genes.

Answer:

Traits are passed down from one generation to another because of DNA.

Explanation:

Genetic inheritance occurs due to genetic material, in the form of DNA, being passed from parents to their offspring. When organisms reproduce, all the information for growth, survival, and reproduction for the next generation is found in the DNA passed down from the parent generation.

A _____________ is like a thread of DNA.


A. chromosome

B. allele

C. genotype

D. ______

Answers

Answer:

Explanation:

The answer is A. Chromosome

CHROMOSOME, is like a thread of DNA

hope it helps.

Fill in the definition of a fossil. A fossil is the _____ physical _____ of _____ life.

Answers

Cycle of the natural life

Help me plsss it’s due soon

Answers

Answer:

the o zone

Explanation:

I think

Answer:

they are being constantly used by living things but plants make oxygen and we breath it in when we breath out we create carbon dioxide there for it is a continuing circle of things happening when this happens it leads to this if you get what im saying

Are human and octopus eyes homologous or analogous?

Answers

They are analogous. Hope this helps
Analogous should be it, they are the same except for octopus don’t have blind spots

What are the characteristics of vitamins and minerals? (Select all that apply.)
They help your immune system fight disease.
They are produced inside the body.
They are gained by the body by eating.
They help the body get energy.

Answers

Answer:

all above

Explanation:

btw those vitamin c gummies are bomb

The characteristics of vitamins and minerals are they help your immune system fight disease and they help the body get energy.

What are the functions of vitamins and minerals?

Vitamins and minerals help us fight infections, heal wounds, build strong bones, and regulate hormones, among other bodily functions. Nutrients and minerals can cause harmfulness whenever consumed in enormous sums.

Vitamins and minerals are essential for healthy growth and development in children. A variety of foods from each of the five food groups can provide vitamins and minerals to children.

In contrast to other dietary components known as macronutrients (such as fats, carbohydrates, and proteins), which are the compounds utilized in the reactions regulated by the vitamins, the vitamins regulate reactions that occur in metabolism.

Learn more about vitamins and minerals:

https://brainly.com/question/14635801

#SPJ3

Are the forelimbs of humans, cats, frogs, and bat wings homologous or analogous?

Answers

They are homologous because they all evolved from the same structure
They all inherited a basic anatomical structure which later became adapted for a different habit and habitats these are regarded as homologous structures

what evidence have you discovered to explain how organs are organized in the body? Pls, I need this right now answer!!!

Answers

For example cells make tissue then tissue goes up to the organs and help the system.
the organ system bc they are organized in ways the are functioning

Which most likely would cause diseases to be spread by polluted water?
A. dumping human waste in rivers and streams

B. runoff that contains fertilizers and pesticides
C. an oil spill resulting from an accident to a ship carrying oil as cargo

Answers

Answer:

a

Explanation: because poop is really unhealthy and full of diseases making everything in the water a problematic factor?

A. Dumping human waste in rivers in streams

1. Write a sentence explaining the relationship between the words DNA, genes, and chromosomes.
2. Name three examples of genetic traits that you inherited from your parents.

Answers

For the second, my skin color, my eye color, and my hair color.
Answer

If you add up all parts of a system then divide by how many parts you are finding the of the system.*

O Kinetic energy
O Force
O average
O danger ​

Answers

kinetic energy !! A ke
It’s kinetic energy!!

Which has the greatest long-term impact on local water availability?
A. runoff
B. climate
C. pollution

Answers

Answer:

answer is most likely B.

Explanation:

Because with climate/ weather change water can change easily for example water can evaporate as it gets hotter and a colder climate can kind of grasp more water.

B, makes the more so most sense and the others don’t match up with any facts on that topic

does the amount of energy and matter change on earth

Answers

Answer:

Yes

Explanation:

In natural systems, both energy and matter are conserved within a system. This means that energy and matter can change forms but cannot be created or destroyed.

Answer:

yes

Explanation:

Other Questions
In the 1300s Jews were often played for causing the plague and solve:100^x=10^(2x+5) What is the answer please I need help The outside of a round swimming pool is 40ft. How far is it to swim from the center to the outside? AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash. Felix has a bucket of golf balls. The table shows the number of golf balls of each color in the bucket.Felix selects a golf ball at random. Based on the information on the table, which statement is true? A 3ft child casts a 2ft shadow at the same time a tree casts a shadow that is 6ft long how tall is the tree? Argentina is considering constructing a bridge across the Rio de la Plata to connect its northern coast to the southern coast of Uruguay. If this bridge is constructed, it will reduce the travel time from Buenos Aires, Argentina, to Sao Paulo, Brazil, by over 10 hours and has the potential to significantly improve the flow of manufactured goods between the two countries. The cost of the new bridge, which will be the longest bridge in the world, spanning over 50 miles, will be $700 million. The bridge will require an annual maintenance of $10 million for repairs and upgrades and is estimated to last 80 years. It is estimated that 550,000 vehicles will use the bridge during the first year of operation, and an additional 50,000 vehicles per year until the tenth year. These data are based on an a toll charge of $90 per vehicle. The annual traffic for the remainder of the life of the bridge life will be 1,000,000 vehicles per year. The Argentine government requires a minimum rate of return of 9% to proceed with the project.(a) Does this project provide sufficient revenues to offset its costs?(b) What considerations are there besides economic factors in deciding whether to construct the bridge Name the part in red:H2 + O2 -> H2O The angle of elevation to a building in the distance is 22. You know that the building is approximately 450ft tall. Estimate the distance to the base of the building The Brownie camera was a popular camera not just because of a great advertising campaign by Eastman but because the average person could use it. Write a brief essay describing at least three ways the Brownie was made easier to use for the average citizen. PLEASE HELP! In the figure below, mR is 66, and mT is 122.Note: Figure is not drawn to scale. What is mQ? A. 58 B. 56 C. 24 D. 124 how did the installment buying impact america life today? HELP PLEASE. urgent help needee Five angles of a hexagon measure 119, 129, 104, 139 and 95 degrees. What is the measure of the sixth angle? Which expression gives the volume of a sphere with radius 16?O A. $ r (262)B. 47(262)O C. (163)O D. 4t(153) When elemental sodium reacts with water, sodium hydroxide and hydrogen will form. What mass of sodium (in grams) must be reacted with excess water to produce 325 mL of hydrogen gas at 25.0oC and 1.15 atm? Which of the following best describes a direct benefit in using redundant routing on the Internet?a. Redundancy often allows messages to be sent on the network even if some network devices or connections have failed.b. Redundancy enables messages to be transmitted with as few packets as possible.c. Redundancy enables network devices to communicate with as few network connections as possible.d. Redundancy prevents network communications from being intercepted by unauthorized individuals. Approximately what percent of the landmass on earth receivesvery little or no rainfall? Select the correct answer.What is the purpose of the IRS?A. to collect taxes and enforce tax lawsB. to provide a collection of domestic and foreign securitiesC. to foster cooperation between nations to solve economic issuesD. to ensure fair global trade practices