What is the relationship between natural selection and genetics?

Answers

Answer 1

Gene guns, other direct gene introduction techniques, or specially built bacterial trucks are all used in genetic engineering to insert genetic material, a process that does not happen naturally.

Natural sexual and asexual reproductive methods are used in conventional breeding, which primarily relies on selection. Through a procedure called genetic engineering, crops can be produced more quickly than through selective breeding by directly changing an organism's DNA.

Any selection procedure that results from an organism's capacity for environmental adaptation is referred to as natural selection. Contrarily, artificial selection refers to selective breeding that is mandated by an external agent, typically humans, in order to increase the frequency of desirable traits.

Learn more about natural selection Visit: brainly.com/question/23929271

#SPJ4


Related Questions

Which of the following best describes the addition of nucleotides to a growing DNA chain? A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate. Co A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of phosphate. Moving to another question will save this response

Answers

Correct statement which best descibes the addition of nucleotide is a) a nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.So,correct option is a.

A nucleoside triphosphate is a nucleotide containing a nitrogenous base bound to a 5-carbon sugar (either ribose or deoxyribose), with three phosphate bunches bound to the sugar. They are the sub-atomic antecedents of both DNA and RNA, which are chains of nucleotides made through the cycles of DNA replication and transcription. Nucleoside triphosphates likewise act as a wellspring of energy for cell reactions and are associated with flagging pathways.

Nucleoside triphosphates can't be consumed well, so they are regularly orchestrated inside the cell. Blend pathways contrast contingent upon the particular nucleotide triphosphate being made, yet given the numerous significant jobs of nucleoside triphosphates, union is firmly directed in all cases. Nucleoside analogs may likewise be utilized to treat viral infections. For instance, azidothymidine (AZT) is a nucleoside simple used to forestall and treat HIV/Helps.

Hence,correct statement is given in option a.

To know more about Nucleoside triphosphates, visit here:

https://brainly.com/question/14077575

#SPJ4

(Complete question) is:

Which of the following best describes the addition of nucleosides to a growing DNA chain?

a)A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.

b)A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate.

c)A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

d)A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of phosphate. Moving to another question will save this response

How do we know whether or not a heteromorphic chromosome such as the Y chromosome plays a crucial role in the determination of sex

Answers

The Y chromosome contains the "male determining gene," the SRY gene. This gene causes testicles to form in the embryo and results in the development of male genitalia. The SRY gene is important in sex determination in mammals and some insects.

Chromosomes are part of the structure of the human body, which consists of DNA and other molecules, and is the place where genetic material is stored.

To determine sex, the so-called X and Y chromosomes. If the embryo's chromosomes are XX, then it is female. Conversely, if the XY chromosome then the fetus will be born as a boy

Sex chromosomes are usually heteromorphic, that is, they show differences (size, shape, or reaction to staining) between their homologous chromosomes. Individuals having heteromorphic sex chromosomes can produce two types of gametes. For example, human males can produce gametes that have 22+X or 22+Y chromosomes.

Learn more about the Y chromosome at https://brainly.com/question/21057614

#SPJ4

For every described currently living species of organism, there are about ________
fossil species.
O 2
O 1/6
O 100
O 6
O 1/100

Answers

For every described currently living species of organism, there are about 1/6 fossil species.

What is fossil species?

Fossil species are species that have been preserved in the fossil record. Fossil species are usually the remains of ancient organisms that lived millions of years ago, and are found in sedimentary rocks. They provide a window into the evolutionary history of the Earth, and are important for understanding the relationships between extinct and living species. Fossil species are also used to reconstruct ancient environments and ecosystems. Fossil species can be identified by their morphology, or physical characteristics such as size and shape.

To learn more about fossil species
https://brainly.com/question/11829803
#SPJ1

How will the positive and negative transcription factor help maintain the homeostasis of the body system. Explain with an example

Answers

The positive transcription factor will help in maintaining the stimulus for homeostasis or even accelerate it. Whereas the negative transcription factor will oppose the effect of the stimulus, it can either increase it or decrease it.

Homeostasis is the maintenance of a steady and equilibrated physical, chemical and internal state of the body. The example of positive transcription factor is: activation of one clotting factor in the body initiates a cascade for the activation of all the other clotting factors.

Negative transcription factor has the example of blood glucose levels of the body. If the level increase transcription factors cause the release of insulin from the pancreatic cells to maintain the homeostasis.

To know more about homeostasis, here

brainly.com/question/3888340

#SPJ4

In a transformation experiment, a sample of E. coli bacteria was mixed with a plasmid containing the gene for resistance to the antibiotic ampicillin (ampr). Plasmid was not added to the second sample. Samples were plated on nutrient agar plates, some of which were supplemented with the antibiotic ampicillin. The results of E. coli growth are summarized below. The shaded area represents extensive growth of bacteria; dots represent individual colonies of bacteria. Plates that have only ampicillin resistant bacteria include which of the following?
a. I only
b. III only
c. IV only
d. I and II

Answers

Option A, The plasmid containing the amp gene was added to the first sample of E. coli, but not to the second sample. Therefore, only the first sample should contain bacteria that are resistant to ampicillin.

This is represented by the shaded area on the plate I, which indicates extensive growth of bacteria. Plates II, III, and IV do not have any shaded area, meaning that there is no extensive growth, and only dots representing individual colonies of bacteria.

Since the plasmid was not added to the second sample it does not have resistance to the antibiotic. This means that plates III and IV, which contain the antibiotic, will not have any ampicillin-resistant bacteria and thus the answer is a. I only.

To learn more about E. coli bacteria at

https://brainly.com/question/18722309?referrer=searchResults

#SPJ4

NEED ASAP!!!
explain how mutations affect genes.

Answers

Explanation:

Random mutations in genes can potentially lead to advantageous characteristics. For example, a mutation in the genetic coding of a bacterium could lead to that bacteria becoming resistant to antibiotics. Mutations change the overall coding of a gene, and are normally harmless. Mutations are changes in the coding of DNA, they can lead to alterations in the polypeptide chain and so can lead to non-functional proteins.

How many total permanent teeth should an adult have, assuming none have been lost or removed? -8 -16 -20 -32

Answers

Answer:

The correct answer is 32 teeth.

Explanation:

Hope it helped:)

Researchers put mice who had been eating either a Low Carb or a Control diet onto treadmills at different speeds and measured heart rate. Their data are below. The R2 values for each line represent • Control O Low carb diet - Control -----Low carb
(Pict. Diagram)
o the significance of the linear fit o whether or not the slopes are significantly different from zero o the amount of variation explained by the regression line o standard deviation of the slope

Answers

Based on the research given, the answer would be C. the amount of variation explained by the regression line

This statistic displays the percentage of the variance in the dependent variable that the independent factors collectively explain. The R-squared statistic offers a simple 0–100% scale to express the degree of the relationship between your model and the dependent variable.

Variation refers to any distinction between individuals within a species or between populations of animals from different species. Genetic diversity is primarily brought about by mutation, but it is also influenced by other biological processes as sexual reproduction and gene flow. Linear regression is a linear strategy for modelling the connection between a scalar answer and one or more explanatory factors. When there is only one explanatory variable, simple linear regression is employed; when there are many explanatory factors, multiple linear regression is utilised.

To learn more about regression line: https://brainly.com/question/17004137

#SPJ4

in what tissues, cells and organ does ependymoma first start

Answers

It begins in the spinal cord or brain

how can the silent march best be described the silent protest

Answers

Answer:

There is no singing or chanting, just the muffled thump of drums.

Explanation:

How do you rule a X-linked recessive pedigree?

Answers

Ruling a X-linked recessive pedigree involves analyzing the family history and pattern of inheritance of a trait or disorder to determine if it is likely to be inherited in an X-linked recessive pattern.

The disorder can be identified by:

Construct a pedigree by gathering information about the family history of the trait or disorder. Identify the pattern of inheritance by analyzing the transmission of the trait or disorder within the family. X-linked recessive disorders typically show a pattern of transmission in which affected males are only found in the direct line of descent from a female carrier. If the disorder is only found in males and not females, or if it is found mostly in males, it could be X-linked recessive.Exclude other possible modes of inheritance. Confirm the mode of inheritance by performing genetic testing. Genetic tests such as DNA sequencing or linkage analysis can be used to identify the specific genetic mutation causing the disorder in affected family members. Identify the specific gene mutation. With the help of genetic testing and linkage mapping it's possible to identify the specific gene and the mutation that causes the disorder.

To know more about Pedigree analysis, click here,

brainly.com/question/14525981

#SPJ4

Buffalo grass is a species of plant found on the grazing prairie of Wyoming. It is a tough grass that has silicates (compounds containing oxygen and silicon) that reinforce its leaves. This variation has allowed this type of grass to survive for many years in an adverse environment. This is an example of which mechanism of evolution? O Mutation O Natural Selection O Gene Flow Genetic Drift​

Answers

As the variation of tough grass that has silicates (compounds containing oxygen and silicon) that reinforce its leaves has allowed this type of grass to survive for many years in an adverse environment, this is an example of b. natural selection.

This particular type of grass has adapted over time to survive in an adverse environment, due to its silicates (compounds containing oxygen and silicon) reinforcing its leaves. This is an example of natural selection, showing how the grass has been able to survive for many years despite the difficult conditions.

The variety of grass characterized by silicates (oxygen and silicon compounds) in its leaves has enabled it to survive in difficult environments over the years. This is a prime example of natural selection at work.

To learn more about natural selection, click here:

https://brainly.com/question/23929271

#SPJ4

What was the most significant conclusion that Mendel?

Answers

The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.

The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.

Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.

The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.

Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.

For more information on Mendel's experiment , visit :

https://brainly.com/question/30097040

#SPJ4

Complete question :

What was the most significant conclusion that Mendel drew from his experiments?

A There is considerable genetic variation in garden pea

B Traits are inherited in discrete units one from each parent

C Genes are composed of DNA

D Recessive genes occur as frequently as dominant ones.

What part of the brain is the "boss" of the autonomic nervous system (ANS)?
A) thalamus
B) pons
C) basal nuclei
D) hypothalamus

Answers

The "boss" of the autonomic nervous system is located in the hypothalamus of the brain (ANS).

What roles does the thalamus play?

The thalamus is your body's central nervous system. Except for the sense of smell, the thalamus is in charge of processing all bodily sensory information before it is sent to the cerebral cortex in the brain for interpretation. The thalamus also plays a role in awareness, memory, learning, attention, and sleep.

How many nuclei does the thalamus contain?

There are around 60 nuclei, or parts, in the thalamus. [1] Each nucleus contains unique pathways for input and a range of output projections, most of which connect to the cerebral cortex.

To know more about hypothalamus visit :

brainly.com/question/9113672

#SPJ4

EMOTIONAL COORDINATION IS. *

1 point

THE ABILITY TO USE PERSONAL ENTHUSIASM TO IMPROVE THE EMOTIONAL STATE

OF OTHERS

THE ABILITY TO QUICKLY REGULATE AN EMOTIONAL RESPONSE WHEN FACED WITH

A VARIETY OF IMMEDIATE SOCIAL AND EMOTIONAL CHALLENGES

THE ABILITY TO APPLY THE ENERGY CREATED FROM AN EMOTIONAL RESPONSE (IE:

ANGER, SADNESS, FRUSTRATION, ETC. ) IN A POSITIVE AND CONSTRUCTIVE WAY

THE ABILITY TO RESPOND POSITIVELY AND OPTIMISTICALLY IN A VARIETY OF

SOCIAL AND EMOTIONAL SITUATIONS, AND TO REGAIN OPTIMISM WHEN NEGATIVE

EVENTS OCCUR

THE ABILITY TO EMPATHIZE WITH OTHERS AND RESPOND APPROPRIATELY AND

PRODUCTIVELY TO PROVIDE SOCIAL AND EMOTIONAL SUPPORT

THE ABILITY TO STABILIZE THE EMOTIONAL RESPONSE TO A POTENTIALLY

UNSTABLE SOCIAL AND EMOTIONAL SITUATION

Answers

The ability to use personal enthusiasm to improve the emotional state of others is called empathy.

The term "empathy" refers to a wide concept that describes one's cognitive and emotional responses to another person's perceived experiences. The possibility of assisting others and displaying compassion rises when one has empathy. Therefore, empathy is the capacity to use one's own excitement to enhance the emotional well-being of others.

It is not required to have the same experiences or situations as others in order to feel and show empathy. Instead, empathy is an effort to comprehend the other person more fully by learning about their point of view. Emotional intelligence is the ability to understand, manage, and control your own emotions in order to reduce stress, communicate properly, empathize with others, conquer challenges, and resolve conflict (EQ).

To know more about emotional intelligence, refer to the following link:

https://brainly.com/question/7905042

#SPJ4

2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each

year, try to capture as many moths as you can.

When you are done, select the TABLE tab and record the percentages of each moth type.

Year

Dark moths

Light moths

o

1

2

3

4

5

Answers

The total number of moths captured yearly is five. Inwhichoneis light moths and the other three are dark moths.

Moths come in a wide range of sizes, with wingspans that range from roughly 4 mm (0.16 inch) to nearly 30 cm (about 1 foot). They are highly adaptive and can survive anywhere but in arctic regions. Moths have scale-like coverings on their wings, body, and legs that fall off when the insect is handled. Moths have sturdier bodies and duller coloring than butterflies. Moths also have recognizable thick or feathered antennae. Moths retain their wings stretched at their sides or folded tent-like over their bodies when at rest, whereas butterflies hold their wings upright.

Learn more about moths here:-

https://brainly.com/question/15101218

#SPJ4

Why do whales need oxygen?

Answers

Whales need oxygen for respiration processes because they do not have gills, and whales are unable to breathe oxygen that is dissolved in water.

The lack of gills, which prevent whales from breathing oxygen dissolved in water, is the most obvious distinction between whales and other fish. Instead, they have lungs, which means that whenever they want to breathe air, they have to come to the surface.

They can stay underwater for hours at a time because they have a very efficient respiratory system that allows their lungs to get the most out of each breath. To put things in perspective, when we are at rest, humans breathe about 12 to 20 times per minute, but they only take in 5% of the oxygen in a single breath. This is in contrast to a whale, which can absorb up to 90% of the oxygen it breathes. This indicates that a whale takes in significantly more oxygen in a single breath than a human does.

Know more about Respiration here: https://brainly.com/question/12605249

#SPJ4

Check the items you included in your answer. Both living things and biotic factors can be alive. Unlike living things, biotic things may not be alive; they may have once lived or came from something living. I included an example of something both living and biotic, such as flowers. I included an example of something biotic, but not living, such as paper. I used compare-and-contrast vocabulary

Answers

You are all aware that the terms "living" and "biotic" are interchangeable since both refer to the measures of life. It includes, among other things, humans, animals, plants, and predators.

Something that is directly derived from living organisms or that is closely related to living organisms can be considered biotic. Biotic organisms may not always be alive, but they can talk for a long time. A biotic substance is one that once existed or originated from a living thing.

Products like rubber, latex, cow dung, paper, and so on are biotic products that are not living, whereas examples like plants and animals, including humans, fall under the category of living.

As a result, Biotic includes, among other things, humans, animals, plants, and predators.

To learn more about Biotic, refer to the link:

brainly.com/question/1657724

#SPJ4

Which of the following organelles are involved in the general category of organelle heredity?
A) mitochondria and chloroplasts
B) R factors
C) Lysosomes and peroxisomes
D) Factors and episomes
E) Golgi and rough endoplasmic reticulum

Answers

The organelle in charge of transmitting hereditary features is the nucleus. The nucleus, represented by the letter Q, is where DNA is located. Choice B seems to be the appropriate answer as a result.

What characteristic of the cell determines heredity?

We now know that the genetic material of the cell is stored in the DNA. Diagram 4-2. On the other hand, the main function of cellular proteins found in chromosomes is to control and bundle extremely long DNA molecules into manageable bundles that can fit into mitochondria and just be easily accessible by them.

What organelle contains the basic components of life's genetic code?

Nucleus. The DNA deoxyribonucleic protein is housed in the nucleus, which is also known as the "command center" of the cell. Every single of the cell's processes, including.

To know more about DNA visit :

brainly.com/question/264225

#SPJ4

Which of the following is true concerning the anatomy of a skeletal muscle fiber?
a. actin and myosin sliding past each other and partially overlapping
b. certain smooth muscle cells can actually divide to increase their numbers
c. tropomyosin
d. myofibrils contain thick and thin filaments

Answers

A protein which regulates the activity of the lactose locus is located outside the lac operator and is encroaching, a globular contractile protein, works with myosin to contract muscles.

The single cells are what?

Unicellular creatures are sometimes known as single-cell organisms. In contrast to multicellular creatures, which are made up of many cells, single cell organisms were minuscule and consist of just one cell. They are capable of functioning as a single cell that is capable of sustaining life.

What are some uses for single cells?

Single-cell sequencing technology may identify individual immune cells, making it possible to distinguish between distinct immune cell types and learn about the relationships between them.

This contributes to our understanding of the intricate immune system and suggests new disease-treating targets.

To know more about single cells visit:

https://brainly.com/question/12296060

#SPJ4

A parent cell has 28 chromosomes and completes meiosis. How many chromosomes result in each cell produced

Answers

If a parent cell has 28 chromosomes then the number of chromosomes in the daughter cell produced after the cell undergoes meiosis is 14 chromosomes.

Meiosis is a cell division process for gamete production. It helps in the sexual reproduction of eukaryotes. Gametes produced from two parents will unite to form the zygote, which thus contains a combination of unique sets of chromosomes inherited from two parents.

Hence each daughter cell will have half the no of chromosomes as that of their parents. So the number of chromosomes in each of  the daughter cells is 28/2 = 14 chromosomes. In meiosis 1 the number of chromosomes becomes half while in meiosis 2 , it is similar to mitosis, so the number of chromosomes remains the same.

For further learning about meiosis, follow the link:

https://brainly.com/question/30080589

#SPJ4

Suppose that each fatty acid in a certain fat can make 9 molecules of acetyl CoA. Predict how many ATP can be made from the fatty acids in this fat

Answers

The number of ATP yielded through fat metabolism which makes 9 molecules of acetyl CoA is 108 ATP.

How many ATP produced on beta-oxidation?

The process of metabolic reactions which convert fatty acids to acetyl CoA is called beta-oxidation. Through multiple steps in beta-oxidation, fatty acids are broken down to produce energy (ATP). Before producing the energy, fatty acids which are made up of carbons must be converted into acetyl CoA in advance.

If 9 molecules of acetyl CoA are produced, it indicates that the fatty acid has 18-Carbons. In other words, each acetyl CoA contains two carbon atoms.

Each acetyl CoA that has been produced, will enter into the citric acid cycle or known as Kreb’s cycle. This cycle yields 3 NADH (9 ATP), [tex]FADH_{2}[/tex] (2 ATP), and 1 ATP. The total ATP result is 12 ATP.

when there are 9 molecules of acetyl CoA, the ATP yielded is 9 x 12 ATP = 108 ATP.

Thus, if each fatty acid in a certain fat can make 9 molecules of acetyl CoA, the amount of ATP that can be made is 108 ATP.

Learn more about beta-oxidation by clicking this link :

https://brainly.com/question/14133986

#SPJ4

what is a consumer that hunts and gathers food

Answers

Names of Consumers that Hunt and Gather food : buffalo, bison, wild goats, reindeer

What is the best evidence we have for evolution ?

Answers

The continuity of the fossil record from ancient to contemporary times may be the strongest fossil evidence supporting evolution.

We don't find things like mammals in strata from the Devonian, the age of fishes, or human fossils alongside dinosaur remains anywhere on Earth. Evolution that is, common descent, gradualism, species diversification, and natural selection are the five hypotheses that Darwin united. A theory is an explanation for how a natural phenomenon functions that has undergone extensive testing through observations and experiments intended to establish the validity of the explanation. In this context, evolution might be considered both reality and a theory. The fact that creatures have altered or evolved over the course of Earth's history is undeniable.

Learn more about Evolution here:

https://brainly.com/question/6111443

#SPJ4

This is English can I still get help!

Answers

Answer: I believe the order of answers should be 2, 3, 4.

Explanation:

Part A seems like it is describing a strange character. Part B is appearing to depict a mysterious event. Part C describes a positive interaction.

(If this is wrong, I am terribly sorry, but I do hope this helps!)

The correct аspect of аn Аmericаn myth:

1. Rip now felt а vаgue аpprehension steаling over him; he looked аnxiously in the sаme direction, аnd perceived а strаnge figure slowly toiling up the rocks, аnd bending under the weight of something he cаrried on his bаck. ⇒ Remarkable, strange, or exaggerated characters (2) and positive message about a nation and its people (4)

2. Her deck once red with heroes’ blood. Where knelt the vаnquished foe. When winds were hurrying o’er the flood. Аnd wаves were white below. ⇒ Set in the past, often remote areas and exiting times (1)

3. Thanks, thаnks to thee, my worthy friend, for the lesson thou hаst tаught! Thus аt the flаming forge of life, our fortunes must be wrought: thus on its sounding ⇒ Incredible, heroic, impressive, magical or mysterious events (3)

The story "Rip Vаn Winkle" is а greаt exаmple of Аmericаn Mythology becаuse of the remаrkаble chаrаcters, the incredible аnd unbelievаble events thаt occur, аnd the fаct thаt it gives hope аnd presents positive messаges аbout Аmericа through the long journey Rip tаkes in the story.

The poem titled 'Old Ironsides' penned by Oliver Wendell Holmes explores the theme of 'pride in bаttle аnd deаth.' The speаker feels proud of receiving аn honorаble deаth. The poem is centered аround а ship thаt served in numerous bаttles but still doomed to be discаrded.

The quote from "Longfellow’s Blacksmith" tells about the Blаcksmith understаnds thаt he cаn forge his own future, by аny method he deems fit. А life worth living will require thousаnds of hаmmer swings, but he is in full control of how thаt hаmmer is swung.

For more information about American myth refers to the link:

https://brainly.com/question/17267555

#SPJ1

What is insertion and deletion called?

Answers

An insertion and deletion is called as a frameshift mutation .

An insertion is a point mutation in which one or more base pairs is added to a DNA sequence. Point mutations is further divided into silent mutations, missense mutations, and nonsense mutations.

Frameshift mutation is considered as a genetic mutation caused by a deletion or insertion in a DNA sequence. This kind of mutation shifts the way the sequence is read. diseases like cystic fibrosis is a result of frameshift mutation that alters the CFTR gene. The harshness of frameshift mutation is reliant on the number of nucleotides and the position of insertion of nucleotides.

To learn more about Frameshift mutation , here

brainly.com/question/14364090

#SPJ4

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1

PLSSS HELP IF YOU TURLY KNOW THISS

Answers

Answer:

It's A.

Explanation:

Because owls and hawks have different Pray to catch and different species

The answer here is a idcverf errrffr we

compare the air pollution of Uttar Pardesh, Arunachal Pradesh, and Meghalaya

Answers

Answer :uttar Pradesh is more polluted than any of these.

Explanation:

Ligaments ere very strong but resistant to stretch Which protein fiber probably predominates?
a. Collagen b. Elastic c. Reticular d. Adipose

Answers

Ligaments are extremely strong but not stretchable. Most likely, collagen protein fiber is predominant.

Which of the aforementioned structures resists stretching?

The primary structural element of connective tissue, collagens withstand tensile or stretching stresses. There are about 40 different forms of collagens, but four of them are the most prevalent.

What distinguishes the holocrine gland from the merocrine and apocrine secretions?

Products are produced and then secreted by merocrine glands. Apocrine gland cells store its fluids until they rupture and discharge their contents, whereas apocrine gland cells release secretions by clamping off the apex region of the cell. In this instance, the cell joins the secretion.

To know more about Collagen visit :

https://brainly.com/question/28320324

#SPJ4

Other Questions
3 ratios that are equivalent to 15/40 The diagram shows the plan for a lawn. A landscaper needs tobuy grass seed to cover the lawn. One bag of grass seed coversan area of 900 yd2. How many bags of seed does the landscaperneed to buy to cover the lawn? Show your work. The Latin root -pac-means peace. For example, the word pactmeans a peace treaty or an agreement. A related word, -pais-, a form of pac-, is the root for appease, meaning to bring peace to. Explain the meaning of each of the following words, based on its root and other word parts.1.pacify2.pacifist 3.appeasement4.unappeasable ASAP 100 POINTS PLUS BRAINLIEST A local rent-to-own business has a television set advertised with a purchase price of $1,095. 0. Calculate the APR if the finance terms are $29. 99 per week for 73 weeks. Round the final answer to the nearest tenth. (4 points) 73. 4% 71. 4% 81. 2% Compare the attestation services provided by independent professionals with other assurance services provided by CPAs. Next, discuss at least two (2) goals of each service and how the service contributes to decreasing the risk of reporting errors or misstatements in financial statements. Provide the underlying principles supporting your response. What was a name for supporters of the Constitution?YeomenFederalistsConmenDemocrats Why are there products from so many different places? who benefits? and why dont we simply make everything ourselves? i need help asappppppp!!!!!! how to you write about civil war and how do you start it helpppppppp Translate and solve: -5 times b is no less than 35. Note: Write your solution in interval notation, The vertices of a trangular plot of land are A(1,5), B(7,5), and C(8,0) If an owner of real property dies without leaving a will and with no legal heirs, what will generally happen to the property Question 2 of 15Select the table that represents a linear function (Graph them if necessary)OA012314378 x 0-012#220323248162m191125 What does Lucynell's response suggest about her perception? How does a free enterprise system provide opportunities for individuals? What is the occurrence of elements properties in which it repeats every after the eight elements? help mark!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! I NEED help on this ASAP!!Thanks! The special operator used to check whether a subquery returns any rows is ____.a. BETWEEN c.LIKEb.EXISTS d.IN What is one thing you hope to learn from class of criminal justice? 2. Autobiographies are written in the ______ person point of view