What trait is recessive in the picture

What Trait Is Recessive In The Picture

Answers

Answer 1

Shortness is the recessive trait


Related Questions


How might compound leaves and leaves with lobed margins be well-suited to windy environments?

Answers

Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

What is a plant adaptation?

A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.

Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.

In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

Learn more about plant adaptations here:

https://brainly.com/question/29594

#SPJ1

. Which describes the function of the cell cycle in such single-celled organisms?
reproduction
repair
growth
protection

Answers

A. Reproduction. Single celled organisms make copies of themselves through mitosis which describes the function of the cell cycle

Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?

A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers

Answers

Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.

How, explain your answer briefly?

The construction of dams in rivers has blocked the path of  some salmons returning to spawning grounds.

The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.

Thus, option "D" is correct.

To learn more about salmons click here:

https://brainly.com/question/16208604

#SPJ1

Who establishes a crime scene?

options:

crime scene photographer

criminal investigator

first responder

district attorney

Answers

Answer:

first responders

Explanation:

no need for explaining

You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.

Answers

A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

What are salinity and conductivity measurements?

Salinity is a measure of the salt content of a water body.

Conductivity is a measure of the electrical conductivity of a solution or substance.

Conductivity increases with increase in salinity.

An estuary is a region where salt water from the sea meet freshwater from a river or stream.

At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.

Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

Learn more about salinity and conductivity at: https://brainly.com/question/2472580

#SPJ1

4. Which statement best describes how scientists formed cell theory?
A:Pasteur observed that cork was made of cells and published his findings
widely,
B:Multiple scientists and observations contributed to the formation of cell
theory.
C:Schwann observed that plants are made of cells and shared his theory at
conferences.
D:Remak wrote cell theory after realizing that cells cannot come from non-
living matter.

Answers

Answer:

A is the answer

Explanation:

please mark me as brainlist

how can global warming lead to changes to the Earth's surface?

Answers

Answer:

It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.

Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?

Answers

The correct options would be B and E.

Variation in population size

The population size of each organism in different zones may not vary much due to the following:

Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.

More on adaptations of organisms can be found here: https://brainly.com/question/1686177

#SPJ1

What process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates?

Answers

Answer:

Precipitation

Explanation:

Precipitation refers to a process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates.

Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.

Answers

Answer:

B.) Can lead to new species that share common ancestors

Explanation:

Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).

We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous

Answers

Answer:

We can mold metals into different shapes because they are _malleable__.

Explanation:

Malleable (ability to be hammered into thin sheets)

3. Meiosis is a process that occurs during cell division that leads to the production of gametes It halves the number of chromosomes that can be passed on to an offspring. It also produces new combinations (variations) of an organism's genetic material Use evidence you obtained from modeling meiosis to show that both statements are true ​

Answers

Answer:

reproduction

Explanation:

different traits

PLEASE HELP PLEASE
Do you think this is a good way to eliminate invasive species from an ecosystem? Do you think the risks of the gene drive getting into another species are worth gaining biodiversity in an ecosystem? Explain your opinion.

Answers

Use of bioagent is a good way to eliminate invasive species from an ecosystem.

What is a good way to eliminate invasive species from an ecosystem?

In my opinion, to eliminate the invasive species from an ecosystem we should find out its bioagent instead of chemical spraying because bioagent does not adversely affected the environment.

The risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem because it leads to many consequences and unpredictable effects on ecosystem.

So we can conclude that use of bioagent is a good way to eliminate invasive species from an ecosystem.

Learn more about invasive here: https://brainly.com/question/1542287

#SPJ1

Yes, it is a good way to eliminate invasive species from an ecosystem. This is because invasive species play a critical role in the limitation of biodiversity of a particular ecosystem.

What is Biodiversity?

Biodiversity may be defined as the sum total of all the variety of living organisms in a particular ecosystem.

No, the risks of the gene drive getting into another species are not worth gaining biodiversity in an ecosystem. This is because it directs considerable influences and unanticipated impacts on the ecosystem.

Therefore, it is well described above.

To learn more about the Ecosystem, refer to the link:

https://brainly.com/question/26551655

#SPJ1

10 points!

A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.

Answers

Answer:

it’s a spore

Explanation:

it should be a spore. It’s because the spore is the haploid.

One possible reason for the rise in the average air temperature at the Earth's surface is that

Answers

Answer:

cimate change

The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which

Answers

Fatty acid tails = hydrophobic
Phosphate heads= hydrophilic

Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?

Answers

The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.

What is Taxonomic classification system?

This is defined as the classification of organisms based on shared characteristics.

This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.

The complete question is:

Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.

Which of the following best explains why a standardized classification system is important to the scientific community?

Read more about Taxonomic classification system here https://brainly.com/question/11724129

#SPJ1

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

The backbone is also known as the vertebral column. Justify in accordance with both the
terms used

Answers

dont say babe lol is it bc i’m black no hehehe rawr im doing this so i can literally get answers for this thing

Which of the following is a natural resource for humans?

A-Cars
B-Electricity
C-Houses
D-Wood

Answers

D. Wood

Wood is a natural resource whereas everything else isn’t.

What factors can limit growth?

competition
amount of sunlight or water
r-selected species
geographic borders

Answers

The answer is

Amount of sunlight or water.

As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.

learn more things about what factors growth

https://brainly.com/question/3944507

Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent

Answers

the correct answer is detergent which is not approved

The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.

What is a hand sanitizer?

Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.

Detergents are not approved during the formation of hand sanitizer.

Thus, the correct option for the given scenario is D.

For more details regarding sanitization, visit:

https://brainly.com/question/4296165

#SPJ2

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factors in their work that could increase their chances of cancer?

Answers

This is the complete question.

Cancer is a disease that is caused by genetic mutations. Which health professionals are least likely to face risk factor

in their work that could increase their chances of cancer?

A. Scientists who work with toxic chemicals

B.therapist who operate radiation machine

C.nurses who treat patients with viral infections

D.researches who study DNA replication

Research that study DNA replication. Thus, option "D" is correct.

What is cancer?

Cancer directs to any one of a considerable number of diseases described by the growth of anomalous cells that separate uncontrollably and have the ability to enter and destroy ordinary body tissue.

Cancer often has the ability to spread throughout your body. Cancer is the second-main cause of dying in the world.

Thus, option "D" is correct.

To learn more about Cancer click here:

https://brainly.com/question/8590464

#SPJ1

What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional

Answers

Answer: (directly proportional)

the reason is the because the meaning of directly proportional is one increasing & decreasing at different rates. when a population takes resources the population grows but the resources sink but not in the same rate unless it would be inversely proportional if the population was increasing and decreasing at the same exact time as the resources

Which feature of the ocean floor includes its deepest parts?

Answers

Ocean Trenches also known as Deep Sea Trenches

For a long time, penicillin was given to people to kill the bacteria which caused ear infections. Lately, some ear infections are not cured by penicillin. Which is the best explanation for this?

Answers

Answer:

Some bacteria have mutated and are not killed by the penicillin

Explanation:

what would most likely happen if a person increased the amount of saturated fat in his or hers diet?

Answers

Answer: If a person increased the amount of saturated fat in his or her diet there is a chance of risk of cardiovascular disease would increase.

Explanation: Increase in the amount of saturated fat in diet results in the increase of levels of cholesterol in blood. This cholesterol is in the form of LDL.

If a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well.

What is the harmful effect of saturated fatty acids?

Because saturated fatty acids are completely saturated with hydrogen, they require more energy to break down and generally remain in the solid at room temperature, as well as inside the body, where they can induce heart-related diseases and obesity by blocking blood vessels. For example, butter contains saturated fatty acids, which are generally not recommended in large quantities.

Hence, if a person increased the amount of saturated fat in his or her diet, then the person would be more likely to suffer from heart and blood vessel-related disease and obesity as well..

Learn more about the harmful effects of saturated fatty acids here.

https://brainly.com/question/14118324

#SPJ2

Describe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease

Answers

Answer:

escribe a trophic cascade (at

least three organisms long)

that would occur if the orca

whale population were to decrease

Explanation:

An organism that is eaten by a predator is

Answers

Prey is a term given to the organism that is eaten by the predators.

Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation

I'll give brainly to whoever response is good !
please help me :C

Answers

Answer:

At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.

Other Questions
TechnologySelect the component that matches the task from a drop-down menu of options.Theprovides a user with a way to interact with the browser.displays content on the screen.coordinates actions between the user and the rendering engine.handles requests for information resources from networked servers.enables a web browser to save browsing information.TheADONE Clare makes a pattern of shapes each shape in the pattern is 1 unit longer and 1 unit taller than the shape before it which picture could show the first three shapes in Clare pattern? A teacup has a diameter of 6 centimeters. What is the teacup's radius?Help please. Type a digit that makes this statement true.32,324,44 is divisible by 6. 5. Sabrina put $3,000 into a Money Market (high-yield savings)account with an interest rate of 2.6% compounded quarterly.a. Write an equation to model the amount in the account overtime.b. Assuming no deposits or withdrawals are made, how muchmoney would be in the account after 15 years? Show yourcalculation.c. How would this problem be different if it was compounded"continuously" instead? Calculate the amount after 15 years.d. Name 2 or more other situations (other than a savingsaccount) where you might encounter compound interest later inyour life. During which event in American history were there clear displays of heroism?A. 9/11 Terrorist AttacksB. Nazi Defeat at StalingradC. Unification of GermanyD. Construction of The Berlin Wall Two hoses A and B together fill a swimming pool in two hours. A does it by herself in three hours less than B. Calculate how many hours it takes each to fill the pool. Which of the following details help us understand the overall context of the story Two Kinds? Select all that apply.The mother is Chinese.The daughter is American.They aren't wealthy.They bought a piano. Need help answering this questions If a company is organized by function, that means it is grouped into departments based on what? A. The type of work people do B. The product being produced C. The type of customer being served D. Location Please select the best answer from the choices provided A B C D The most prominent stylistic characteristic of the sixth stanza is the use of a. simile o b. allusion o c. apostrophe d. anaphora o e. metaphor submit A racoon may live longer when it only eats vegetables.What is the student doing?A. Forming a hypothesis B. Collecting data C. Drawing a conclusionD. Making a prediction what are your top 3 barriers?write specific ways on how you can overcome these barriers Match the graph to the correct inequality X-3X -3 Make an organized list which shows all possible outcomes when four fair coins are flipped.Each coin lands facing either heads up (H) or tails up (T).What is the probability that at least three coins land facing tails up? Give the probability as a percent, rounded to the nearest whole number.P(at least three tails) = Speaker A: "The president does not like the law Congress is voting on. He does not think it is the right thing for the government to do." Speaker B: "If the president really wants to stop the law, he has the power to do so." Speaker C: "Even if the president does stop the law, Congress can still have its way if two- thirds of the members are willing to vote for it." Speaker D: "Congress may get its way, but the president is confident that when the law is heard by the Supreme Court, it will be declared "unconstitutional." Which statement congressional power is referred to by Speaker C? A. veto B. override C. judicial review D. impeachment N(t) = 100,000e(t 10)2/8The secant line can be used to approximate the derivative at a particular point on the graph by placing either the right or the left side of the secant line on that point. (Round your answer to the nearest integer.)(a) Consider the point on the graph at t = 10 days and set one end of the secant line at this point. Set the other end of the secant line at the point that is 1 day earlier. What is the approximation of the slope of the graph at t = 10 days using this secant line?(b) Consider again the point on the graph at t = 10 days. Set one end of the secant line at t = 10 days and the other end at the point that is 1 day later. What is the approximation of the slope of the graph at t = 10 days using this secant line? what function is increasing at the highest rate help I will gave u brilliant answer please help Find the length of side xx in simplest radical form with a rational denominator.