What type of rocks were once another type but have been changed as a result of intense heat and pressure?

Answers

Answer 1

Metamorphic Rocks were once another type but have been changed as a result of intense heat and pressure.

On Earth, rocks can be igneous, sedimentary, or metamorphic. When rocks are heated to the point of melting, which results in magma, igneous rocks are created. Sedimentary rocks are produced by the cementing, compaction, or crystallisation of new mineral grains that are bigger than the original crystals, or by the compression of sediments. Rocks that have undergone metamorphism have undergone a full transformation due to heat and pressure.

The parent rock may be igneous, sedimentary, or even a different metamorphic rock. Metamorphic, which meaning "To Change Form," is a Greek term. Stresses that raise pressure and heat can transform solid rock into a new type of rock. There are three primary factors that trigger metamorphism. The three agents are those which result in a change in temperature, stress, and chemical changes.

Learn more about Metamorphic rocks here:

https://brainly.com/question/2615484

#SPJ4


Related Questions

What two coins add up to 30 cents but one isn't a nickel?

Answers

One is not a nickel, while the other may be a coin equaling 5 cents. So the first coin is a quarter, which equals 25 cents. This results in a total of 30 cents.

30 cents is made up of a quarter and a nickel. You might also use three dimes or six nickels.

The situation at hand is a type of riddle. It is assumed that the total value of the two US coins is 30 cents.

One is not a nickel, while the other may be a coin equaling 5 cents. So the first coin is a quarter, which equals 25 cents. This results in a total of 30 cents.

As a result, the coins are a nickel and a quarter.

Learn more about to nickel

https://brainly.com/question/3542561

#SPJ4

Item 6 What caused most of the current landscape features of the Alps region? Ice movement and deposition of eroded material Tectonic plate movement Global warming Accelerated river erosion

Answers

The Alps region is a unique geographic area in Europe, and its current landscape features have been shaped by a variety of forces.

In particular, three major factors have had the most influence on the formation of the Alps region: ice movement and deposition of eroded material, tectonic plate movement, and accelerated river erosion.

Ice movement and deposition of eroded material is the oldest of the three forces, and is the primary factor responsible for the formation of the Alps region. During the Quaternary period, which began approximately 2.6 million years ago, the Alps region was covered by glaciers. As the glaciers moved, they carved out deep valleys and created jagged peaks. The material that was deposited as the glaciers melted was also important in forming the landscape, as it filled in valleys and created the flat areas of the Alps region.

In addition to ice movement and deposition of eroded material, tectonic plate movement has also been a major factor in the formation of the Alps region. The region is located at a convergent plate boundary, where the African plate is moving northwards and colliding with the Eurasian plate. This collision has caused movement of the Earth’s crust, leading to the formation of the Alps Mountains and other landscape features.

Learn more about Alps Mountains at : https://brainly.com/question/15480250

#SPJ4

A rocket starts from rest and moves upward from the surface of the earth. For the first 10 s of its motion, the vertical acceleration of the rocket is given by ay=(2. 90m/s3)t, where the +y-direction is upward

Answers

Therefore, the rocket is moving at 108.62 m/s when it is 325 meters above the earth's surface. This is the necessary remedy as a result.

A rocket must accelerate to a speed of at least 7.9 kilometers per second (4.9 miles per second) if it is to launch into space from the surface of the Earth. The orbital velocity, 7.9 km/s, which is more than 20 times the speed of sound, is referred to as this velocity.Keep in mind that the fuel's burn time is t.Although it seems remarkable, the speed is still 0.001% of the speed of light. Spacecraft are among the fastest artificial objects. They accelerate to a speed of 25,000 mph using rockets to escape the gravity of Earth (40,000 kmh)

To know more about rocket here

https://brainly.com/question/29040817

#SPJ4

What steps have been taken by the government to protect the flora and fauna?

Answers

The United States government has taken several steps to protect the flora and fauna within its borders. They are as follows:

The Endangered Species Act (ESA).The National Wildlife Refuge System.The Wild and Scenic Rivers Act.The National Park Service.

Species that are in danger of extinction are protected by the Endangered Species Act also known as ESA. Before undertaking any actions that might have an impact on a protected species, government entities are required by law to consult with either the National Oceanic and Atmospheric Administration or the U.S. Fish and Wildlife Service.

The United States has a network of protected lands and waters totaling around 150 million acres called the National Wildlife Refuge System, which is dedicated to the conservation of wildlife. There are more than 560 national wildlife refuges around the country.

Development is prohibited along several rivers and streams under the Wild and Scenic Rivers Act in order to preserve the rivers' free-flowing, natural characteristics.

The National Park Service, a federal agency, is in charge of overseeing a system of national parks, monuments, and other protected areas. These open spaces exist to safeguard the local natural and cultural resources.

Learn more about flora and fauna at

https://brainly.com/question/28391735

The Endangered Species Act, or ESA, provides protection for species that are facing extinction. Governmental bodies are obligated by law to communicate with either the National Oceanic and Atmospheric

What is the atmosphere?

The term atmosphere is the layers of gases environing a planet or other celestial body. Earth's atmosphere is constituted of about 78% nitrogen, 21% oxygen, and one percent other gases. The atmosphere is a layer of gases that borders Earth. It is held close to the surface of the planet by Earth's gravitational attraction.

The National Wildlife Refuge System, a network of protected lands and waters comprising around 150 million acres in the United States, is devoted to the conservation of wildlife. Around the nation, there are more than 560 national wildlife refugees.

Therefore, Governmental organizations are required by law to contact the National Oceanic and Atmospheric Administration (NOAA) or

Learn more about the atmosphere here:

https://brainly.com/question/26767532

#SPJ2

______ is caused by deforestation, overgrazing, and overworking the soil Group of answer choices desertification depletion of aquifers salinization monoculture

Answers

Desertification is caused by deforestation, overgrazing, and overworking the soil.

Desertification is an environmental process in which dry, arid areas of land become increasingly uninhabitable and unable to support plant and animal life. This process is caused by a variety of factors, including deforestation, overgrazing, and overworking the soil.

Deforestation is the removal of trees and other vegetation for various purposes, such as to create space for agriculture and urban development. Without trees, the soil is left exposed to the elements and is unable to retain moisture. This leads to the soil becoming dry and barren, creating the perfect conditions for desertification.

Overgrazing is the practice of having too many animals grazing on a given area of land. This can cause the land to become overly depleted of vegetation, which can lead to desertification. Overgrazing can also lead to soil erosion and loss of fertility, as the animals trample and consume the vegetation that would otherwise help retain moisture.

Overworking the soil is the practice of tilling the soil too often or too deeply. This can lead to the depletion of organic matter and soil organisms, which are essential for maintaining soil health. Without the organic matter and soil organisms, the soil is unable to retain moisture, leading to desertification.

All of these practices can have devastating effects on the environment and can lead to desertification. Deforestation, overgrazing, and overworking the soil can all contribute to the depletion of aquifers, salinization, and monoculture. These effects can render entire regions uninhabitable, making it difficult for plants, animals, and humans to survive. Therefore, it is important to take steps to protect our environment and prevent the effects of desertification.

Learn more about Deforestation at :https://brainly.com/question/17178423

#SPJ4

The Grand Canyon has much more than pretty scenery. It contains an amazing diversity of rock formations with an abundance of fossils hidden within. These fossils provide clues about past environments. The sedimentary rocks exposed throughout the canyon are rich in fossils, including fossils of these marine (ocean) brachiopod shells.

QUESTION: How does fossil evidence help you explain how the Grand Canyon formed? Write your answer

Answers

The formation of the Grand Canyon defies the explanations offered by evolutionary geologists. the have argued that fossil-bearing rocks were largely laid down in local floods by rivers dumping sediments into waters.

What is Grand Canyon?

The Grand Canyon, also known as Gran Caón del Colorado or Gran Caón de Hopi (Hopi: ngtupqa, Yavapai: Wi:kai:la, Navajo: Bidáá Haazti Tsékooh, Southern Paiute language: Paxa'uipi), is a steep-sided canyon cut by the Colorado River in Arizona, United States.

The Grand Canyon stretches for 277 miles, can be up to 18 miles wide, and can be more than a mile deep.

Grand Canyon National Park, Kaibab National Forest, Grand Canyon-Parashant National Monument, Hualapai Indian Reservation, Havasupai Indian Reservation, and Navajo Nation all encompass the canyon and surrounding rim.

Theodore Roosevelt frequently travelled to the Grand Canyon region to go hunting and take in the grandeur. He was a strong supporter of its preservation.

To know more about grand canyon, visit:-

https://brainly.com/question/13394878

#SPJ1

Uplift of the Colorado Plateau used to be a key step in the eventual formation of Grand Canyon.

The motion of plate tectonics lifted the rocks high and flat, creating a plateau thru which the Colorado River may want to cut down.

What fossils are observed in the Grand Canyon?

The sedimentary rocks uncovered for the duration of the canyon are prosperous with marine fossils such as crinoids, brachiopods, and sponges with various layers containing terrestrial fossils such as leaf and dragonfly wing impressions, and footprints of scorpions, centipedes, and reptiles.

How old is the oldest fossil proof in the Grand Canyon?

The oldest rocks exposed in the canyon are ancient, 1,840 million years old.

Learn more about  fossil evidence here:

https://brainly.com/question/29638332

#SPJ1

At Earth's surface, warm temperatures are associated with ________.
a) high pressure
b) cyclones
c) anticyclones
d) low pressure
e) adiabatic cooling

Answers

Answer: D. Low pressure

In addition to the transition from desert to tropical climate, what else coincides with the African Transition Zone

Answers

The African Transition Zone, a transitory region between Christian and animist-dominated Subsaharan Africa and Islamic-dominated North Africa, separates Subsaharan Africa from North Africa.

The climate is dry and predominately made up of category B climates to the north of the African Transition Zone. Tropical weather with class A climates dominates in the south. At the African Transition Zone, there is also a change in religion. Christianity and animism are dominant in the south, while Islam is dominant in the north.

The Sahel, a semi-arid area of grasslands formed by the collision of the Sahara Desert and central African rain forests, is the environment of the African Transition Zone. Over 3500 miles long and covering over a million square miles is the African Transition Zone.

For more questions on African Transition Zone

https://brainly.com/question/8845553

#SPJ4

Question 17 of 20
When you walk the middle path in Buddhism, you reach equilibrium between
the two extremes of
and
A. love; hate
O B. self-respect; self-abuse
OC. passivity; violence
OD. self-indulgence; self-denial
SUBMIT

Answers

In Buddhism, you can achieve equilibrium among the two extremes or sensual pleasure and self-mortification by taking the middle road.

Who is the Buddhist god?

Buddhists reject the existence of a supreme entity or god. Instead, they concentrate on obtaining enlightenment, a condition of inner tranquility and knowledge. It is stated that followers have attained heaven when they achieve this spiritual level. The founder of the faith, Buddha, is regarded as an exceptional individual but not a deity.

What are the five tenets of Buddhism?

The commandments are vows to refrain from doing things like committing murder, stealing, engaging in social misconduct, swearing, and becoming. According to Buddhist teaching, they are designed to help people grow as people so they might advance toward enlightenment.

To know more about Buddhism visit:

https://brainly.com/question/13523033

#SPJ1

If the P-wave arrives at 1:00pm and the S-wave arrives at 1:07pm, how far from the epicenter is this location?

Answers

If the P-wave arrives at 1:00pm and the S-wave arrives at 1:07pm, Seismic wave travel time data and triangulation are needed to calculate the epicenter-to-P-wave and S-wave distance.

What is the epicenter?

Generally, To determine the distance from the epicenter to the location where the P-wave and S-wave were detected, you would need to use seismic wave travel time data and a method called triangulation.

This involves measuring the arrival times of the P-wave and S-wave at multiple seismograph stations and then using the difference in arrival times to calculate the distance to the epicenter.

Without more information, it is not possible to determine the distance to the epicenter from the arrival time of just one P-wave and one S-wave.

Read more about epicenter

https://brainly.com/question/28136716

#SPJ1

What type of seed is Monggo?

Answers

Vigna radiata, sometimes known as mung bean or simply mongo, is a legume grown in Asia for its delicious seeds and sprouts.

The mung bean is a popular edible legume seed in Asia (India, Southeast Asia, and East Asia), as well as in Southern Europe and the United States. In areas where meat is scarce or people are largely vegetarian, the mature seeds provide a vital supply of digestible protein for humans.

Mung beans (Vigna radiata) are a kind of legume that is tiny and green. They have been grown since prehistoric times.

It is still produced extensively in Southeast Asia, Africa, South and North America, and Australia, mostly for its protein-rich edible grains.

Learn more about to Mongo seed

https://brainly.com/question/29781478

#SPJ4

If a geologist found preserved mud cracks, he or she could conclude that the environment in which they formed ________.

Answers

If a geologist found preserved mud cracks, he or she could conclude that the environment in which they formed was once an area of drying or desiccation.

Mud cracks, or desiccation cracks, form in mud layers that have been exposed to drying. As the mud dries, it contracts and forms a series of cracks that can range from a few millimeters to several centimeters in size. The shapes of these cracks are usually polygonal and are typically segmented by radial cracks.

Mud cracks form when water evaporates from the surface of a mud layer, leaving behind a dry surface. This process is most common in areas with low rainfall, such as deserts, and in areas with a high rate of evaporation, such as the margins of saline lakes. The mud cracks form when the surface layer of mud dries faster than the underlying layer. As the surface layer contracts, cracks form, eventually becoming interconnected and forming a network of cracks.

The presence of mud cracks is an indication of a past environment of drying or desiccation. The size and shape of the cracks can also provide clues about the rate of evaporation and the amount of water present in the environment when the cracks formed. For example, if the mud cracks are shallow, then the evaporation rate was likely low. However, if the mud cracks are deep, then the evaporation rate was likely high.

Learn more about evaporation at :https://brainly.com/question/5019199

#SPJ4

How many more times intense is an earthquake that measures eight on the Richter scale than an earthquake that measures five explain your answer?

Answers

The earthquake will be 1000 times more intense when it is measured 8 on the Richter scale.

Richter scale is the numerical scale which measures the intensity of earthquake with the help of seismographic oscillations. While each whole number increase in magnitude corresponds to a tenfold rise in measured amplitude, it corresponds to a 32-fold increase in energy release.

Each level on the Richter scale is 10 times stronger than the previous one.

Richter scale measuring 8 is three levels up than the value 5 on the scale.

Hence, the earthquake having 8 on the Richter scale will be ( 10 × 10 × 10) = 1000 times more intense than the earthquake having 5 on the Richter scale.

Read more on Richter scale.

https://brainly.com/question/4089234

#SPJ4

Which geologic term or phrase explains why the reason rock layers typically form parallel to each other

Answers

The geologic term or phrase that explains the reason rock layers typically form parallel to each other called original horizontality.

Nicholas Steno, proposed the concept of original horizontality (1638–1686). According to the Principle of original horizontality, rocks with horizontal strata were initially deposited in a horizontal orientation. These findings support the theory of plate tectonics, which postulates that folded strata are the result of the movement and collisions of huge plates of the Earth's crust, and so prove that the Earth has not been static and that immense forces have been at work over extended periods of time.

To learn more about original horizontality, click here:

https://brainly.com/question/1308215

#SPJ4

In Christian religions, there is often a belief that people will go to heaven after they die if they have been "good" in their lives on earth. What type of
cultural trait is this?

O A. social institution
OB. material culture
O. C. assimilation
O D. attitude towards the unknown



Answers

Answer:

I believe the answer is D. Attitude towards the unknown

Explanation:

Hope it helps:)

Isn’t it B I’m not sure

Where is Groundwater found brainly?

Answers

Groundwater is water that exists underground in cracks and crevices in soil, sand, and rock. It is stored in and slowly travels through aquifers, which are geologic formations of soil, sand, and rocks.

Water that resides below in saturated zones under the land surface is referred to as groundwater. The water table is the top surface of the saturated zone. Groundwater, contrary to common perception, does not generate underground rivers.

The ground penetrating radar (GPR) device is used to identify subterranean water. GPR is an exciting new technology for detecting and identifying aquifer water and nonmetallic mining.

Aquifers are vast reservoirs of Earth's water, and people all around the world rely on it in their everyday lives.

Learn more about to Groundwater

https://brainly.com/question/14241380

#SPJ4

which of the following surfaces would soil erosion most likely take place?

Answers

Soil erosion mostly take place at moist place containing high rainfall and Deserty area

How do you grow Mongo seeds in water?

Answers

Answer: The first step is to soak the dry beans so they absorb water to begin the germination process. Any beans that float will not be viable. Given a day of soaking, the beans will swell as they take in water. Mung beans more than double their weight, and nearly triple their volume.

Explanation:

Cosmogony seemed to be a universal belief at one time in our prehistory. All of the following are examples of cosmological landscapes in the Pre Spanish Conquest Americas EXCEPT: Group of answer choices Chemi Shanidar Mounds in Mesa Verde, Colorado

Answers

Cosmogony seemed to be a universal belief at one time in our prehistory. All of the following are examples of cosmological landscapes in the Pre Spanish Conquest Americas EXCEPT:Chemi Shanidar Mounds in Mesa Verde, Colorado

A "model" that represents their idea of how the universe was originally created would be developed by cosmogony experts.When they come up with their theory, they frequently incorporate knowledge from epistemology and philosophy of science. Cosmogony, in astronomy, is the study of the universe's evolutionary behavior and the origin of its characteristic features.

At the moment, the majority of them are concentrating on studying the solar system to observe the origin. See planetesimal for scientific theories regarding the unanswered question of the solar system's origin; protoplanet; Nebula of the sun Cosmology provides an overview of the development of astronomical theories regarding the universe's structure; See the big-bang model for theories about how the universe started; theory of steady states.

Learn about cosmogony:

https://brainly.com/question/12451869

#SPJ4

What is the layers of rock from oldest to youngest?

Answers

Answer:

The layers of rock in the Earth's crust are generally arranged in order from oldest to youngest, with the oldest rocks on the bottom and the youngest on top. This is due to the fact that, over time, new layers of sediment are deposited on top of older layers, forming a layered or stratified structure.

The specific layers of rock in the Earth's crust can vary depending on the location, but in general, the layers from oldest to youngest are:

The crust: The outermost layer of the Earth, consisting of solid rock. The crust is divided into two main types: the continental crust, which makes up the continents, and the oceanic crust, which makes up the floor of the oceans.

The mantle: The layer beneath the crust, consisting of molten rock (magma) and solid rock. The mantle is divided into two main regions: the upper mantle, which is solid, and the lower mantle, which is partially molten.

The core: The innermost layer of the Earth, consisting of a solid inner core and a liquid outer core. The core is made up of iron and nickel, and is responsible for the Earth's magnetic field.

It is important to note that the layers of rock in the Earth's crust are not always clearly defined, and there is often overlap and mixing between different layers. Additionally, the ages of different layers of rock can vary significantly within a particular region, as different layers can be formed at different times and under different conditions.

How did Mapp v. Ohio set a legal precedent?
1. The Supreme Court’s ruling extended the exclusionary rule to state courts.
2. The Supreme Court’s ruling made it legal to own por..graphy.
3. The Supreme Court’s ruling allowed officers to enter homes within reason.
4. The Supreme Court’s ruling required that state courts uphold anti-gambling laws.

Answers

The case of "Mapp v. Ohio" set a legal precedent because the Supreme Court’s ruling extended the exclusionary rule to state courts. The Option 1 is correct.

Why is case of Mapp v. Ohio significant?

In Mapp v. Ohio, the United States Supreme Court ruled (6-3) on June 19, 1961, that evidence obtained in violation of the Fourth Amendment to the United States Constitution, which prohibits "unreasonable searches and seizures," is inadmissible in state courts.

In doing so, it held that the federal exclusionary rule, which prohibited the use of unconstitutionally obtained evidence in federal courts, was also applicable to states under the incorporation doctrine, the theory that most protections of the federal Bill of Rights are guaranteed against the states under the Fourteenth Amendment's due process clause, which prohibits states from denying life, liberty, or property without due process of law.

Read more about Mapp v. Ohio

brainly.com/question/13054438

#SPJ1

How does the ozone layer affect life on earth?
a. causes respiratory illness
b. increases photosynthesis in plants
c. causes damage to living tissue
d. filters out harmful ultraviolet radiation
please select the best answer from the choices provided a b c d

Answers

Answer: Answer is d (Filters out harmful UV radiation)

Explanation:

The ozone layer is present in the second layer of the atmosphere which is known as the Stratosphere. In this layer ozone filters out the ultraviolet radiation from the sun's rays before entering the earth's surface. UV rays cause harmful effects on human life such as sunburn, premature aging, and skin cancer.

But the depletion of the ozone layer due to greenhouse gases is leading to an increase in ground-level ultraviolet radiation because it is an effective absorber of UV rays.

which of the following agricultural irrigation practices is the least useful for conserving water?
"flood and furrow" irrigation: in which fields are liberally flooded with water that may evaporate from standing pools (90% of irrigation worldwide) -Drip or root-level irrigation is up to 90% efficient.

Answers

"Flood and furrow" irrigation is the least useful for conserving water because it has the lowest efficiency. Drip or root-level irrigation is up to 90% efficient, compared to flood and furrow irrigation which may result in up to 90% evaporation from standing pools.

Flood and furrow irrigation is a traditional method of irrigation where fields are flooded with water and allowed to stand in pools. As the water stands in the field, a significant amount of it evaporates before it can be absorbed by the plants. This results in a low efficiency of water use, with estimates ranging from 30-70%.

Drip or root-level irrigation, on the other hand, delivers water directly to the roots of the plants using a system of underground pipes or emitters. This method is much more efficient as the water is delivered directly to where it is needed and there is little to no evaporation. The efficiency of this method is estimated to be up to 90%.

In summary, "Flood and furrow" irrigation is the least useful for conserving water because it results in high evaporation and low efficiency, while drip or root-level irrigation is more efficient in delivering water to the plants and conserving water.

Learn more about irrigation:

https://brainly.com/question/29892276

#SPJ4

Which ethnicity in
South America is
a mixture of the
Spanish colonists
and the
indigenous
people?
A. criollo
B. mestizo
C. caballo

Answers

The answer is B, Mestizo

The boundary between which two tectonic plates is most similar geologically to the plate boundary at the Mid-Atlantic Ridge

Answers

The boundary between which two tectonic plates are most similar to the plate boundary at the Mid -Atlantic Ridge is Eurasian and Indian-Australian

Parts of the Earth's crust and uppermost mantle that make up the lithosphere are called tectonic plates. The two distinct materials that make up tectonic plates are:Ocean crust Continental crust Because the Mid-Atlantic Ridge (divergent plate boundary) is located along the plate boundary where ocean floors are formed as plates separate from one another, the plate boundary between two tectonic plates (the Eurasian and Indian Australian boundary) appears geologically similar to the Mid-Atlantic Ridge.

The Mid-Atlantic Ridge is part of the world's longest mountain range and is a divergent or constructive plate boundary along the Atlantic Ocean floor.At the intersection of the crustal plates that make up the Atlantic Ocean floor, you'll find this ridge.The world's longest mountain range is made up of this ridge, which is spread out by a divergent tectonic plate.

Read more about Mid-Atlantic Ridge

https://brainly.com/question/23321834

#SPJ4

A student suggests that all of Earth's changes happen very quickly. Which term best describes this claim

Answers

A student suggests that all of Earth's changes happen very quickly. The term best describes this claim is Catastrophism.

ABOUT CATASTROPHISM

Catastrophism is an idea that Earth in its past was affected by various catastrophic events that occurred suddenly, quickly, and affected the entire earth.

The dominant paradigm in terms of geology at the moment is uniformitarianism (sometimes it is also called gradualism), which is the idea that gradual changes affect the present appearance of the earth. This view holds the belief that the present is the key to the past and that everything continues as it did in the beginning. Recently, an increasingly inclusive and unified view of geological events has been developed, changing the scientific consensus on the acceptance of some past catastrophic events.

Learn more about Catastrophism at https://brainly.com/question/7930785.

#SPJ4

Answer: Catastrophism

Explanation: I'm big brain so I know I'm right

What were the common characteristics of Greek city-states ?

Answers

Greek city-states shared a few traits in common, including the fact that their populations were often tiny and their residents were all acquainted with one another.

Citizens choose the representatives they wanted to represent them in these democracies. They were very proud of their city-state and all that it had accomplished. Poleis, commonly referred to as greek city-states, were a distinct type of political structure that emerged in the ancient greek world. They were distinguished by a common language and culture, and residents of their small, autonomous towns or cities.

These cities typically had fortifications to protect them, and they had their own unique laws and customs. Greek city-states had democratically elected governments that included citizen participation in decision-making.city-states in greece. were towns that served as independent nations. were apart from one another. Regardless of their distinctions, greek city-states all worshipped the gods of mount olympus to varied degrees and shared the same ancient greek language.

To know more about greek city states visit:

https://brainly.com/question/14700788

#SPJ4

What was the primary way the firms in the south differed from those in the north?

Answers

The fact that southern farmers used a plantation system to generate cash crops set them apart from their northern counterparts.

All 13 American colonies utilized slave labour throughout the colonial era (1600–1775). Slaves were employed in the shipbuilding industry, among others, throughout the North. Slaves were employed throughout the South to produce lucrative crops including indigo, rice, and tobacco.

After America gained its independence and began making its own laws, attitudes about slavery altered. While some states began to ban slavery after 1800, others continued to practice it. One of the most significant changes was that Southern states concentrated primarily on cultivating cotton, a single very significant cash crop. America became the world's biggest cotton exporter.

Despite its economic success, slavery had a number of unpleasant side consequences, including the abuse of African Americans and conflicts between pro- and anti-slavery residents.

For more questions on Slavery during the Civil War-

https://brainly.com/question/1020924

#SPJ4

How did James Stanley Gilbert feel about the Panamanian jungle?

Answers

Gilbert never lived to see the Panamanian jungle tamed.

What is a jungle?

A jungle is land that is covered with dense forest and tangled vegetation, usually in tropical climates.

The jungle is the richest habitat on Earth. Over the intervals of time, different parts of tropical areas have provided a variety of flora and fauna, together with newer species discovered annually.

The tropical jungles have been the home to indigenous peoples, who have shaped traditional cultures and civilizations based on the environment.

The  vegetation is sufficiently dense to hinder movement by humans, requiring that travelers cut their way through.

Learn more about jungle here:

https://brainly.com/question/841224

#SPJ1

Is it possible to continue to harvest all of the natural resources needed for making paper:
i. in the short-term?
ii. in the long-term?

Answers

Yes, it is possible to continue to harvest all of the natural resources needed for making paper in both the short-term and the long-term. The key is to ensure sustainable practices are being implemented to ensure that resources are being used responsibly and that the environment is being protected. This includes using methods such as sustainable harvesting, ensuring that trees are replanted after harvesting, and implementing conservation efforts to protect natural resources.

Other Questions
Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10 2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each year, try to capture as many moths as you can. When you are done, select the TABLE tab and record the percentages of each moth type. Year Dark moths Light moths o 1 2 3 4 5 What was Hale's purpose in the play? What is the smallest positive multiple of $13$ that is greater than $500?$ Complete this table so it shows a relation that is not a function.X2-4-3y317-5 Which saint is buried at Durham Cathedral? Cara has been outside in humid weather for about five minutes. Her body can tell that the temperature has increased. Describe what her body might begin to do in order to maintain homeostasis while Cara is gardening in the heat. How do these changes help Caras body adapt? A 62-year-old man who has had a worsening cough for several months now complains of dyspnea. He also has fatigue and has experienced a 15-lb weight loss. A chest radiograph shows hilar lymphadenopathy and a right lung mass.What other studies might be helpful in arriving at a definitive diagnosis?What are the risk factors for tumors of the lung? Mg + _________HCI _____ H + _____ MgCh How do you find the two missing sides of an acute triangle? Is Managua the biggest city in Nicaragua? The school district is served by four buses, each of which delivers students to three different schools. You know the cost of transporting each of the students to each of the schools, and you want to determine the least expensive way to get all of the students to their schools. If you use Excel Solver for this analysis, how many different variable cells should you use? 4 07 12 O 16 Question 21 / 58 submit Jump to unanswered question: A small business celebrates serving 5110 customers in their first year of business how many customers did they average each day Which sentence is incorrect? A. -3 > -8 B. -4 > -7 C. -2/5=0.4 D. -5/2=0.4