What was a result of the social problems presented in the 1917 political cartoon?

A Government leaders introduced healthcare reform laws

B Lobbyists focused attention to the power of corporate monopolies

C Women work to improve conditions in tournament houses

D Progressive worked to ratify a prohibition amendment

What Was A Result Of The Social Problems Presented In The 1917 Political Cartoon? A Government Leaders

Answers

Answer 1
D, will be the answer
Answer 2
should be c or d if not then sorry

Related Questions

Which ancient civilization is most closely related to the Plateau of Tibet?


A.China

B.Egypt

C.Kush

D.Sumer

Answers

Answer:

A

Explanation:

The Tibetan Plateau is regarded as "the third pole" and "the roof of the earth." The majority of its territory is in the Chinese provinces of Tibet and Qinghai. Here you'll find intriguing geographical, historical, cultural, and travel-related facts so you may learn everything there is to know about "the world's roof."

About The Tibetan Plateau:

The Tibetan plateau is a high-altitude territory mostly around China that is at least 3,000 meters (9,800 feet) over sea level and is surrounded by the Himalayas and fewer mountainous regions.

With the Pamir Plateau to its west and the Loess Plateau to its east, the Tibetan Plateau commences at the southern edge of the Himalayas and extends northward to the northern boundary of the Kunlun Mountains and the Altun Mountain.

It stretches over around 2,800 kilometers (1,700 miles) from east to west and up to 1,500 kilometers (900 miles) from north to south, covering a total area of about 2.5 million square kilometers (1 million square miles).

For more information about The Tibetan Plateau refer to the link:https://brainly.com/question/12084118

****HELP***

Which statement most accurately describes the education of middle class girls and boys during the late Industrial Ago?

A Girls and boys enjoyed equal educational opportunities

B. Few middle class children went to school because they had to work

C Education increased for boys, but most girls were denied an education

D. Boys were more likely than girls to receive instruction in science and mathematics,

Answers

Answer:

Its D

Explanation:

A.
B.
C
Or d
Please help

Answers

Answer:

The answer is B.) Well trained but unprepared for frontier fighting

Match each culture description with correct civilization

Answers

Where are the choices

Answer:

what are the answers?

Explanation:

Select the correct answer.
How did the Dawes Act threaten the way of life of Native Americans?
O A.
It forced the tribes to adopt white traditions and customs.
O B.
It dissolved tribal governments that administered the tribe's affairs.
C.
It reduced the tribe's sovereignty by dividing their communal lands.
D.
It forced the tribe to mix with white settlers in the new towns.
O E.
It created conflict among tribe members through unequal land distribution.
Reset
Next

Answers

Answer:

I like your led lights but the answer is c

Explanation:

The Dawes Act threaten the way of life of Native Americans is it reduced the tribe's sovereignty by dividing their communal lands. The correct option is (C).

What do you mean by the Dawes Act?

Under President Grover Cleveland, the Dawes Act, also known as the Dawes Severalty Act or the General Allotment Act, was passed in 1887 and gave the federal government the authority to divide up tribal territories.

The Dawes Act's primary objectives were land distribution, job training, education, and divine intervention. Each head of a Native American family received either 160 acres of agriculture or 320 acres of pasture land. They were given 80 acres if they were unmarried.

Therefore, the Dawes Act threaten the way of life of Native Americans is it reduced the tribe's sovereignty by dividing their communal lands.

To know more about the Dawes Act, visit:

https://brainly.com/question/17687316

#SPJ2

What role do federal taxes play in our economy?

Answers

Primarily through their impact on demand. Tax cuts boost demand by increasing disposable income and by encouraging businesses to hire and invest more. Tax increases do the reverse. These demand effects can be substantial when the economy is weak but smaller when it is operating near capacity.

Explanation:

Primarily through their impact on demand. Tax cuts boost demand by increasing disposable income and by encouraging businesses to hire and invest more. Tax increases do the reverse. These demand effects can be substantial when the economy is weak but smaller when it is operating near capacity.

4. Respectable woman + avian creature =

can you solve it to me plz​

Answers

Answer:

Respectable woman+avian creature=Cleaned Dishes and Laundry done

Explanation:

I’m confused as to what the question is?

QuestIOn 12 OT 20:
Select the best answer for the question.
12. What did Orhan, leader of the Ottomans, do to establish unity within the empire?
O A. He gave every citizen a free plot of land.
OB. He forced everyone to convet to Sunni Islam.
OC. He destroyed all Hindu temples.
O D. He began minting coins.
D Mark for review (Will be highlighted on the review page)
<< Previous Question
Next Question >>

Answers

Answer:

D. He began minting coins.

Explanation:

Prior to the rule of Orhan gazi, the vast majority of transaction made in ottoman empire was conducted under a bartering system. (a product is exchanged with another product).

This system was flawed because we can't really know the value of a product that is exchanged. So most of the time, it wouldn't really be equal.

In 1327s, The ottoman Empire started to use coin as their main method of transaction. Orhan Gazi'r rule happened between 1324 to 1360 ,  So this event was occurred under his leadership.

Which of the following was the largest West African empire?

Answers

Answer:

Songhai

Explanation:

Under the rule of Sonni Ali, the Songhai surpassed the Malian Empire in area, wealth, and power, absorbing vast areas of the Mali Empire and reaching its greatest extent. Following Ali's reign, Askia the Great strengthened the Songhai Empire and made it the largest empire in West Africa's history.

Is an economic system that relies on a free market capitalism

Answers

Answer:

The capitalist economic model relies on free market conditions for the creation of wealth. The production of goods and services is based on supply and demand in the general market.

Answer:

Yes! (And God bless it too!)

Defenition of capitalism: Capitalism is an economic system in which private

individuals or businesses own capital goods. The production of goods and

services is based on supply and demand in the general market—known as a

market economy—rather than through central planning—known as a planned

economy or command economy!

What did the government do to help solve the problems of the cities?

sent the immigrants home
closed the cities
passed laws
loaned money

Answers

The correct answer is c : Passed laws
I think the answer was is c but I’m not sure

There were no railroads in 1832 to transport the Native Americans to their new lands. They travelled mostly by foot, covered wagon, horseback, or boat. Using this map and your knowledge of US history and geography, what do you think the journey was like for Native Americans? Use specific evidence from the maps to support your claims.

Answers

Explanation:

We may assume that the pathway also for natives is incredibly difficult and ultimately extremely lengthy, according the maps and rail path.

Any natives became missing during the trip, and the tough journey was not completed by certain natives. Approximately 3,103 natives have fled, but only 2,273 natives have arrived in Mar. Plantation Wabbers, Fort Chocolate, Lee's Creek, and Campground Illinois.

The map was not attached here. However, from the knowledge of US history, the journey must have been arduous for the Native Americans. They must have passed through prairies, mountainous regions, and rivers to get to their new lands.

After the Native Americans were reassigned to new lands, they must have made difficult journeys to their new lands.

They must have passed rough terrains and crossed rivers on boats to get to their destinations.

Animals of burdens like horses might have also been used on these journeys.

Learn more about Native Americans here:

https://brainly.com/question/6501916

How did the Jay Treaty of 1794 create division within the United States? Pro-British Americans were angered that the US government agreed to trade with Britain. Pro-French Americans were angered that the US government agreed to trade with Britain. Pro-British Americans were angered that the US government chose to remain neutral. Pro-French Americans were angered that the US government agreed to trade with France.

Answers

Answer:

Pro-French Americans were angered about trading with the Brits

Explanation:

Answer:

B

Explanation:

What contributed to New York City's terrible pollution problems in the late 1800s? Choose all answers that are correct. pneumatic subway insufficient sanitary services horse and pig manure oil refineries

Answers

Answer:

horse and pig manure

the insufficient sanitary services

Explanation:

The major contributors to New York City's terrible pollution problems in the late 1800s were horse and pig manure which littered the streets and also the insufficiency of the sanitary services to clean them up and keep the areas clean.

Answer:

b and c

Explanation:

took the test

The president can appoint anyone they want to the cabinet and they always get the job.
True or false?

Answers

Answer:

false

Explanation:

they need to be a judge, ambasseters, ministers, consuls etc

8. What action did the United States and Britain take in Iran?
OA.They distributed aid so that the Iranians could fight off the Soviet Union
OB.They confiscated lands and gave them to Israel
OC.They invaded and seized oil fields, established a democracy, and signed trade deals
OD. They executed a coup. overthrew the Iranian Prime Minister, and installed a dictator that was frendly to the nterests

Answers

Answer:

Iran was the overthrow of the democratically elected Prime Minister Mohammad Mosaddegh in favor of strengthening the monarchical rule of the Shah, Mohammad Reza Pahlavi on 19 August 1953, orchestrated by the United States.

The action the United States and Britain take in Iran was they executed a coup, overthrew the Iranian Prime Minister, and installed a dictator that was friendly to the interests

What happened in the 1953 Iran coup?

The 1953 Iranian coup d'état, known in Iran as the 28 Mordad coup d'état was the overthrow of the democratically elected Prime Minister Mohammad Mosaddegh in favour of strengthening the monarchical rule of the Shah, Mohammad Reza Pahlavi on 19 August 1953.

Did the US support the Shah of Iran?

Following the coup, the United States financed the re-installed Shah. In the first three weeks, Washington gave Iran $68 million in emergency aid and an additional $1.2 billion over the next decade. In this era that ensued, until the fall of the Shah in 1979, Iran was one of the United States' closest allies.

Learn more about the 1953 Iran coup here:  https://brainly.com/question/2709734

#SPJ2

Select all the scenarios in which the executive branch is correctly checking the other branches.

Answers

Answer:

The President vetoing a law.

(Can be overridden by the legislative branch with enough votes)

The executive branch declaring executive orders, which are like proclamations that carry the force of law

(Can be declared unconstitutional by the judicial branch.)

Explanation:

John Pory believed that the colonies were already almost perfect and nothing could go wrong. In his eyes he saw perfection except three things according to him, “three things there be, which in a few years may bring this colony to perfection; the English plow, vineyards, and cattle.” He also said a regular colonist worker could raise themselves to the value of 200 pound sterling which is $270.45 USD which at the time, was very rich. Pory mentioned how that seemed very rare or impossible, but such people could do it. Overall, John Pory believed that the colony was in good shape, the economy was striving, and the colonists were doing just fine.

In the excerpt from the Mayflower Compact, the pilgrim leaders wanted to become almost one and form a set of rules, laws, and constitutions that would benefit the colonies. I know this because at the end it stated, “and by virtue hereof, to enact, constitute, and frame such just and equal laws, ordinances, acts, constitutions, and offices . . . “ I knew they wanted to come together as one big civil body because it stated, “covenant and combine ourselves together into a civil body politic for our better ordering and preservation and furtherance of the ends aforesaid.” This evidence showed to me that they didn't want the rules to be unfair, and unequal however, they wanted to do the opposite of that and make sure everybody had equal rights and treatment.

Garangula, a chief of one of the Iroquois tribes, believed nobody should be limited to travel, or marketplace relations. However, anyone should be allowed to do what they please and feel like. Since he wanted to emphasize the fact that none of his people were subject to French or English colonial rule, he said this to his people, “We are born free. We neither depend upon [the governor of New France] nor [the governor of New York]. We may go where we please . . . and buy and sell what we please.” This showed to me he was a strong, responsible and fearsome leader since he wanted everyone to know they can do what they want if they choose.


CAN SOMEONE PLEASE REPHRASE THIS WHOLE PIECE. PLEASE!

Answers

Answer:

In what way would you like this rephrased?

Explanation:

What could be the thesis for "How, why and, when did prehistoric Britain develop?" It's the first time I'm writing a short essay and I have no idea how to start

Answers

Answer:

I would write how and why they developed and write about the thing they developed whatever it is

How did Black Oklahoman’s contribute to the larger Civil Rights Movement?

Answers

Answer:

Explanation:

Katz Drug in downtown Oklahoma City was the setting of what's referred to as the tipping point in the nation's civil rights movement. That's where, in the fall of 1958, Clara Luper and 13 black children participated in a sit-in, silently and non-violently protesting segregation at the store's lunch counter. One of the greatest achievements of the civil rights movement, the Civil Rights Act led to greater social and economic mobility for African-Americans across the nation and banned racial discrimination, providing greater access to resources for women, religious minorities, African-Americans and low-income families.

Which group of people hold the power to vote in a democracy? *
O The nobles
O The people/citizens
O The monarch or tyrant
O The church/clergy
please hurry

Answers

Answer:

The church/clergy

Explanation:

American settlers in the 1830s and 1840s began to look to Oregon and the far West for settlement because

A) there was no more available land in North America.
B) the transcontinental railroad made reaching the West much easier.
C) the land of the Great Plains was considered not suitable for farming.
The answer is C I took the test!

Answers

Answer:

C

Explanation:

Edge 2020

(Adding this here for anyone who needs it in the future.)

Answer:

C) the land of the Great Plains was considered not suitable for farming.

Explanation:

Hope it helps! :)

How did the isue of states rights contribute to the outbreak of the Civil War?
a. Southern states claimed the right to secede.
b. Southern states claimed the right to nullify federal laws.
c. Southern states demanded a new presidential election.
d. Southern states agreed to abolish slavery.

Answers

A. Southern states claimed the right to secede

Q: Which power of Congress helps ensure domestic tranquility?

A. Providing a check for executive power


B. Passing laws to guarantee protections under the Bill of Rights


C. Resolving disputes between states < ?


D. Passing laws to improve the economy

Answers

Answer:

The answer is A. providing a check for executive power

i do belive it is D, Passing laws to improve the economy

Match each inventor with the invention he created or modified.
Henry Ford
assembly line
Alexander Graham Bell
*
telephone
Samuel Morse
electric lightbulb
The Wright Brothers
telegraph
Thomas Edison
airplane

Answers

Answer:

The answer is below

Explanation:

1. Henry Ford:- Assembly line, this was invented in 1913

2. Alexander Graham Bell:- Telephone, was invented in 1876

3. Samuel Morse:- Telegraph: this was invented in the 1830s

4. The Wright Brothers:- Airplane, this was invented in 1903 by Wilbur and Orville Wright is known as The Wright Brothers

5. Thomas Edison:- Electric lightbulb: this was invented in 1879

please answer i will have you as brainliest ​

Answers

Answer:

It D

Explanation:

Answer:

A.Jewish people become leaders in the Roman Empire

Explanation:

Who did the early colonists rely on heavily for food?

Answers

Answer:

Trade

Explanation:

They relied on the Native Americans for trade, and some colonists tried to fish and farm, but farming in the northern colonies did not work out.

What was the dominant pattern of race relations in colonies?

Answers

Answer: white colonizers conquered land where nonwhite people lived

Explanation:

What was the impact of the Citizenship Act of 1924?
A. It gave American Indians the right to vote.
B. It allowed American Indians to sell their plots of reservation land.
C. It made American Indians citizens once they completed an assimilation program.
D. It forbade American Indians from protesting federal policies.

Answers

Answer:A. It gave American Indians the right to vote.

Explanation:

Napoleon’s French empire was the greatest empire since the ... empire

Is it the British Empire?
Or the Roman Empire ?

thanks !

Answers

roman !! i’m 90% sure this is correct bte

Answer:

British... look below

Explanation:

Both of the empires listed were great but the British empire was right before the French. The Roman empire was 1000+ years before. The Roman empire was similar to the French one as they both controlled much of Europe. The British empire didn't control Europe. It controlled the Americas and much of Indonesia/Asia. So it is kind of tough to say but if you are going by the amount of years between them, then its the British.

HOWEVER, if you are talking about the size and amount of power, then probably Roman. But the way this question is phrased, it seems like its talking about years (which would then be British). Sorry I made this a bit confusing lol

Other Questions
what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x