What was Queen Elizabeth's purpose for her speech?

Answers

Answer 1
Her speech was expected to address their concerns about pricing, based on the recent economic issues facing the country. But to everyone's surprise, Elizabeth instead used the occasion to express the love she felt for her subjects, and how she viewed her position as their queen.

Related Questions

why do you think people dedicated a float to Alexander hamilton?

Answers

Answer:

Alexander Hamilton was a founding father of the United States, who fought in the American Revolutionary War, helped draft the Constitution, and served as the first secretary of the treasury. He was the founder and chief architect of the American financial system.

Explanation:

He shaped the financial, political, and legal systems of the young United States. His ideas on racial equality and economic diversity were so far ahead of their time that it took the nation decades to catch up with them. Hamilton made the early republic work, and set the agenda for its future.

How does King's letter show the importance of religious thought in the civil rights movement?

Answers

Answer:

In his 'letter from Birmingham jail', King wrote of his Christian duty “to carry the gospel of freedom” across America (King 1963:78). He compared civil rights protestors' acts of civil disobedience to the resistance of biblical dissidents, Shadrach, Meshach and Abednego.

Explanation:

what are potential fears people may have with a minority group/ religious group in power?

Answers

Answer:

People fear that there will be no freedom to do as they wish.

Explanation:

(T/F) European colonialism had little to do with the emergence of apartheid in South Africa, and the apartheid policies reflect solely the racism of the Afrikaner nationalists.

Answers

Answer:

I disagree with the above statement because without Europeans banning slave trade within their country, the rise of slavery would not have grown in Africa creating apartheid/segregation. The increase in demand for slaves was due to gold being found in South Africa. South Africa now started to have more slaves, slaves that were abundant to them because of the laws against slavery now placed in Europe. It's good that Europe stopped slavery from happening, however it did not stop it world wide. I could see however, an argument to this. The Africans chose to segregate themselves from one another and chose cheap labor over morally right high payed labor.

*Remeber just an opinon*

The colonial rule exercised by Europe over the South Africa has no relation with the emergence of apartheid affecting the racial class of Africans.

The statement is false.

What was apartheid?

Apartheid was the concept relating to differentiating the people on the basis of black or white, that is , the racial class.

The expansion of European empires had been done to conquer the colonies in Africa in order to exported the valuable resources from them and also exploited them a lot. Africa was having abundance of gold, rubber, timber and diamonds which Europeans wanted to take them away.

Therefore, the provided statement is false.

Learn more about the apartheid in the related link:

https://brainly.com/question/3811942

#SPJ2

The Union victory at ______ opened the door to central Georgia

Answers

Ch-at-an-oo-ga

is the answer trust me, put it all together for sum reason it said I had inapropraite words so I had to write it like dat

What is ngo Dinh dime connection to Vietnam war

Answers

Answer:

As president of South Vietnam (1955–63), Ngo Dinh Diem assumed dictatorial powers. Diem's heavy-handed tactics against the Viet Cong insurgency deepened his government's unpopularity, and his brutal treatment of the opposition to his regime alienated the South Vietnamese populace, notably Buddhists.

What was a job needed for a successful cattle drive?
a. President
b. Principal
Ć Trail Boss
d. Security Guard

Answers

Answer:

C. Trail Boss

Explanation:

A trail boss is the person that is in charge of a cattle drive.  A security guard would be more in a shepherd's perspective in keeping his livestock safe.

Anson Jones was the leader of which of the following?

A) Spain when a it ruled Texas
B) Texas when it was a republic
C) Mexico when it controlled Texas
D) Texas when it was a state​

Answers

C, hope this helps. Hope this helps .
The answer is c , Mexico when it controlled Texas

PLEASE HELP!!!


Use the percentage given to figure out how many colonists were originally from Germany. Use the population estimate for 1 780 in your calculation. Remember that percent is a comparison of a part to a whole. To calculate using a percentage, use this formula.

X/100 = part/whole

Answers

Answer:

Explanation:

= x/100

x=1780

= 1780/100

= 1.78

why is Victor villasenor telling this story? / Does his culture influence his writing?

Answers

Answer:

yes his culture influence his story

How much did the price of a barrel of oil increase during the embargo?

A. stayed the same
B. tripled
C. quadrupled
D. doubled

Answers

Answer:

C. quadrupled

Explanation:

The oil crisis of 1973 which started in October of the same year was caused by an embargo placed by OAPEC who targeted countries they perceived were supporting Israel during the Yom Kippur War.

As a result of this embargo, price of oil quadrupled, from a price of $3 per barrel to almost $12 in 1974.

What event was most responsible for Germany becoming an independent nation?

Answers

Answer:

In 1871, Germany became a nation-state when most of the German states unified into the Prussian-dominated German Empire. After World War I and the German Revolution of 1918–1919, the Empire was replaced by the semi-presidential Weimar Republic.

Explanation:

Which is most likely true of the Iliad and the Odyssey, which contain the story of the Trojan War? Homer wrote the stories as entertaining fiction. Homer wrote a well researched history of the conflict. Homer’s stories are based on a group of history books that survived the war. Homer recorded stories passed down orally through many generations.

Answers

Answer:

I think it is A

Explanation:

Because I took the test

Which power is reserved to the states in the us federal system?a. printing and coining money
b. setting the legal driving age
c. making treaties with other countries
d. declaring war
Please help!

Answers

Answer:

b. setting the legal driving age.

Explanation:

Printing and coining money is left to the US national treasury, and not the states.

Declaring War is left to the Congress and Executive Branch, and is not a power of the states.

Treaties was a power that was taken away from the states and given to the federal government, in an effort to make a coherent and more unified United States of America.

~

Answer:

b

Explanation:

which of the follow is a chemical change​

Answers

Answer: Metal rust

Explanation: Because its changing color

PWEASE UWU

Underproduction led to price decreases, thus affecting the economy of Texas during the 1930s.

True
False

Answers

Answer:

True

Explanation:

Answer:

Trueee

Explanation:

Why did only the 3rd estate paid taxes in the French society?​

Answers

Answer:

Hello There!!

Explanation:

Here is the answer:The reason the Third Estate paid all the taxes under the Bourbon monarchy in France is that the kingdom had an inefficient, outdated tax system.The tax burden therefore devolved to the peasants, wage-earners, and the professional and business classes, also known as the Third Estate.

hope this helps,have a great day!!

~Pinky~

In the United States, the end of World War I is remembered as ____________________.


Veterans Day


Armed Forces Day


Armistice Day


Memorial Day

Answers

Answer:

Armistice Day

Explanation:

What does 1 hanggang 2 talatang talumpati mean?
Give an example.​

Answers

Answer:

??????????????

Explanation:

are these correct !! History

Answers

Yes !! They are correct

(20 points) GIVING BRAINLIEST TO WHOEVER ANSWERS CORRECTLY!!!!!
in your own words (no plagiarism) Describe The Battle of Appomattox Court House, including people present for the surrender.

Answers

Answer:

isnt it plagiarism to copy off someones elses work.. dont think too much about it clear ur mind and write it in YOUR OWN words

Explanation:

how does Georgia's transportation systems allow Georgia businesses to reach markets around the nation as well as in foreign countries?

Answers

Answer:

Because of our transportation systems, producers and service providers in GA can buy their materials from all over the country AND the world which puts Georgians at an advantage over people in other areas of the country who don't have railroads, ports, numerous interstates, and an INTERNATIONAL airport

The U.S. providing aid to another country after a natural disaster like a
hurricane/earthquake is an example of foreign policy.
O True
False

Answers

Answer:

True

Explanation:

Which of these is true about the Olmec writing system?
A. It used characters similar to those used by the Inca.

B. It used a system of hieroglyphic symbols.

C. It is the oldest writing system in the world.

D. It has been found mostly in scrolls and books.

Answers

Answer:

B

Explanation:

Brainliest please

The statement that best indicates the Olmec writing system is the utilization of hieroglyphic symbols.

Option B is the correct answer.

Who were Olmecs?

Olmecs referred to the civilization in the times of Mesoamerican culture in 1200 BCE and spoke the Mixe-Zoquean language.

The Olmec writing system comprised of both scripts namely, syllabic and hieroglyphic. In that writing system, the hieroglyphic writing was further classified into two parts, that were, phonetic hieroglyphics consisting of both signs of syllabic and logographic and another was pure hieroglyphics consisting of only signs relating to pictures.

Therefore, the use of hieroglyphic symbols represents the Olmec writing system.

Learn more about the Olmec writing system in the related link:

https://brainly.com/question/907004

#SPJ2

what kind of jewelry is Harrapan

Answers

Answer: This collection of gold and agate ornaments includes objects found at both Mohenjo-daro and Harappa. At the top are fillets of hammered gold that would have been worn around the forehead. The other ornaments include bangles, chokers, long pendant necklaces, rings, earrings, conical hair ornaments, and broaches.

Explanation:

After reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.

Answers

Answer:

After reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.

Explanation:

What main idea links all three of the article excerpts contained in th passage together? A) Taxation rates should be applied equally and fairly to all people. B A little bit of kindness goes a long way in trying to change the world. C) No one deserves to be lonely, and everyone deserves to be loved. D African-Americans had to fight long and hard to receive equal rights in America.What are the dimensions of the product? 2 6 4 1 -3 0 x -3 -2 -8 2 3 5 1 x 2 2 x 2 3 x 2 3 x 3Can somebody help me with this pleaseAfter reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.Can someone help? It's due todayWhat are the dimensions of the product? 2 6 4 1 -3 0 x -3 -2 -8 2 3 5 1 x 2 2 x 2 3 x 2 3 x 3After reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.After reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.Can someone help? It's due todayWhat are the dimensions of the product? 2 6 4 1 -3 0 x -3 -2 -8 2 3 5 1 x 2 2 x 2 3 x 2 3 x 3After reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.

Answer please, US history

Answers

The second one is correct.

Passover is related to what event in Jewish history? The final plague in Egypt during the Exodus O the forty years of traveling and wandering through the deser the creation of the five different books of the Torah O Abraham's covenant with God and promise to Jewish peopl​

Answers

Hello there!

Passover is related to the final plague in Egypt during the Exodus. The holiday is called such because the angel of death passed over the Jews when the angel carried out the final plague.

Does this help?

P.S. Brainliest would be appreciated, if you deem me worthy of such. :)

Prior to 1828, why did many Americans feel that their voices weren’t being heard in the political system? Why did these voters support Jackson?

Answers

Answer:

Growth, expansion and social change rapidly followed the end of the WAR OF 1812. Many an enterprising American pushed westward. In the new western states, there was a greater level of equality among the masses than in the former English colonies. Land was readily available. Frontier life required hard work. There was little tolerance for aristocrats afraid to get their hands dirty.

The west led the path by having no property requirements for voting, which the eastern states soon adopted, as well.

Explanation:

Which was one way the culture of the South differed from the culture of the North in the years leading up to the Civil War?
A.
Northern culture was more influenced by Hispanic traditions than the South.
B.
Northern culture was more influenced by Asian traditions than the South.
C.
Southern culture was more influenced by African traditions than the North.

Answers

Answer:

The Answer is C

Explanation:

Southern Culture was more influenced by african traditions then the north

Answer:

the answer is C.

Explanation:

Other Questions
Ms. Morrison is purchasing a house and needs to finance a $150,000 mortgage fromthe bank with an annual percentage rate (APR) of 3.8%. She is financing it over 30years and making monthly payments. What is the monthly payment? Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number. Complete the proof.Given: ABBP=CBBMProve: CBA~PBM Below shows a process that occurs in cells. The type of building blocks represented by the letters A, B, and C in this process are:A: NucleotidesB: CodonsC: Amino AcidsD: Nitrogen bases Why do you think superstitions and conspiracies are so powerful? Explain. A kicked soccer balleventually comesto rest. Whatforce causesthis?ce find the square rootV 196 please help me with this question Refer to You Should Meet Katherine Johnson for a complete version of this text.What is the overall structure of You Should Meet Katherine Johnson?Comparison, because Katherines accomplishments are compared with other figures in space history.Problem and solution, because Katherines ability to answer questions using math are described.Chronological, because the important events of Katherines life are presented in order.Cause and effect, because the effects of Katherines life decisions are examined in detail.