What were Social and Political changes experienced by African Americans from Reconstruction to the Jim Crow Era. please give me the answer in CER form!

Answers

Answer 1

The social and political changes that happened in the Jim Crow era was that African Americans were later given freedom politically and socially to vote and inclusivity.

Changes in the Jim Crow era

Claim: African Americans experienced significant social and political changes from the Reconstruction era to the Jim Crow era.

Evidence: After the Civil War and the abolition of slavery, African Americans were granted citizenship and the right to vote through the 14th and 15th amendments to the US Constitution. During the Reconstruction era, African Americans held political office at the local and state level, and some even served in Congress. However, following the end of Reconstruction in 1877, Southern states began to enact discriminatory laws, known as Jim Crow laws, which restricted the rights and freedoms of African Americans. These laws enforced racial segregation and voter suppression, effectively denying African Americans the right to vote and access to education, housing, and employment opportunities.

Reasoning: The changes in laws and policies towards African Americans during this period were driven by the white supremacist desire to maintain racial hierarchy and control over black people in the South. The end of Reconstruction and the rise of Jim Crow laws represented a significant reversal of the progress made during the Reconstruction era and marked a period of increased oppression and discrimination for African Americans.

Read more on Jim Crow laws here:

https://brainly.com/question/13463805

#SPJ1


Related Questions

What challenges did Tejanos experience in the early years of the Republic of Texas?

Answers

Answer: In the new Republic of Texas, Tejanos found that they constituted a subordinate minority of the population.

Explanation:

The United States has long prided itself on being the longest-running "democracy" in the world. Of course, there has always been a debate: since the United States has a history of lack of universal suffrage (slavery, Jim Crow laws, systematic exclusion of minorities from voting, etc.) In a sense, can the history of the United States until recently be regarded as the history of a "democratic country"?

Answers

Based on a historical perspective and the context of the question, it is concluded that the United States can be regarded as the history of a "democratic country."

What is a Democratic Country

A democratic country is a country that is known to have the practice of civil liberties and fundamental political freedoms, which are not only respected but also reinforced by a political culture conducive to the thriving of democratic principles.

While it is known that the United States has a history of lack of universal suffrage such as slavery, Jim Crow laws, systematic exclusion of minorities from voting, etc., it must also be noted that it was the act of democracy that negotiated the creation and eventual abolition of these practices.

The idea of slavery, systematic exclusion of minorities, and Jim crow laws were originally established based on negotiations that stemmed from democratic practice, and eventually, it was abolished based on democratic processes such as executive, legislative, and judiciary.

Hence, in this case, it is concluded that while there was a history of lack of suffrage in the United States, it does not disprove the fact that the United States is a democratic country.

Learn more about Democratic country here: https://brainly.com/question/22468379

#SPJ1

According to the 2021 World Freedom Report released by the think tank Freedom House, democracy has been on the decline for 15 consecutive years, and some of the biggest setbacks have occurred in the United States and India. What happened?

Answers

Answer:

In the United States, the 2020 elections were marred by a lack of trust in the electoral system and attempts by President Donald Trump to undermine the legitimacy of the election results. In India, the government has taken steps to undermine the independence of the judiciary and the media, and has used a controversial citizenship law to target religious minorities.

Explanation:

Please help me if anyone knows this
• A seasonal shift in the prevailing winds of southern Asia.

• The region receives heavy rainfall in the summer.

• Winter is drier as the Himalayas block moisture from the north.


What natural phenomenon is described by the information in the box?


A.Typhoon
B.Moonsoons
C.El Nino
D.Tsunami

Answers

The correct answer is B. Monsoons.

The natural phenomenon described in the box is monsoons. Monsoons are seasonal shifts in the prevailing winds that bring heavy rainfall to southern Asia in the summer and drier conditions in the winter due to the Himalayas blocking moisture from the north.

Lean more about Monsoons:

https://brainly.com/question/12538852

Answer:

Correct Option - B. Monsoons

Explanation: A monsoon is defined as a seasonal shift in the predominant, or strongest, winds in a certain area. It is more like a yearly wind shift across a region than a single storm like a typhoon or hurricane. The differential in temperature between a land mass and the nearby ocean causes a monsoon to occur. Much of the tropics experience rainy and dry seasons as a result of monsoons. The rainy season is brought on by the summer monsoon, which occurs between April and September. Moving inland, warm, humid air from the Indian Ocean delivers heavy rainfall and a humid atmosphere. In contrast, the winter monsoon ushers in the dry season between October and April, however it is frequently weaker than the summer monsoons due to the Himalayan Mountains.

where is Israel country situated?

Answers

Israel is located in the Middle East, along the eastern Mediterranean coast. It is bordered by Lebanon to the north, Syria to the northeast, Jordan and the West Bank to the east, Egypt and the Gaza Strip to the southwest, and the Red Sea to the south.

Describe the Renaissance (what, where, when, effects, cause

Answers

The Renaissance was significant primarily because it was portrayed as a break from the dying medieval era in Europe, basing its traits on Greco-Roman culture from Classical Antiquity.

In the Renaissance, art started to demonstrate to the public the beauty of the human form, which was not just for God to be praised. People and their shapes began to be cherished, with appearances that were as true to reality as possible being the most prized. Light and color were expertly utilised in the Renaissance to depict situations and feelings. The Renaissance saw the introduction of the perspective technique, which greatly advanced art by allowing for the representation of depth, the third dimension. The artwork then began to appear more lifelike. The 14th to 16th century saw the Renaissance, a revitalization of European arts and sciences characterized by a value for Classical Antiquity (painting, sculpture, literature). restoring the traditional principles that were outlawed in the Middle Ages and resulting in the real revolution in art.

To know more about Renaissance on

https://brainly.com/question/3263570

How does each level impact an organization?

Answers

Answer:

In an organization, each level of management plays a specific role and has a different level of impact on the organization.

Explanation:

Top-level management: This includes the highest level of executives in an organization, such as the CEO, CFO, and presidents. Top-level management is responsible for setting the overall strategy and direction of the organization, and they have a significant impact on the overall success or failure of the company.

Middle-level management: This includes managers at the divisional or departmental level. Middle-level management is responsible for implementing the strategies and plans set by top-level management, and they have a significant impact on the day-to-day operations of the organization.

Lower-level management: This includes supervisors and team leaders who manage front-line employees. Lower-level management is responsible for overseeing the work of front-line employees and ensuring that they are meeting the goals and objectives set by higher levels of management. They have a direct impact on the productivity and efficiency of the organization.

In summary, each level of management plays a critical role in an organization, and the impact of each level can be felt throughout the company. Top-level management sets the overall direction and strategy, middle-level management implements those plans, and lower-level management ensures that the work is carried out effectively.

To learn more about Impact of each level in an organisation

https://brainly.com/question/17745941

https://brainly.com/question/14514803

main writter of the declaration of independence thomas

Answers

Answer:

Jefferson

I wish you luck in your assignments.

The main writer of the declaration of independence Thomas Jefferson.

How did Thomas Jefferson write the declaration of Independence?

Thomas Jefferson, known for his eloquent writing style and reserved manner, became the principal author. Rough Draft of the Declaration As he sat at his desk in a Philadelphia boarding house, Jefferson drafted a "common sense" treatise in “terms so plain and firm, as to command [the] assent” of mankind.

Therefore, The main writer of the declaration of independence Thomas Jefferson.

Learn more about Thomas Jefferson here: https://brainly.com/question/14242343

#SPJ4

5. It is a rainy day: you are trying to persuade your friend to go for a run with you. using ethos pathos and logos.

Answers

You can utilize pathos to convince your friend to join you for a run on a wet day. Simple audience appeal through emotional persuasion is all that pathos entails.

Define the term ethos, pathos and logos?

When we try to persuade others of anything using logic but instead of trying to appeal to their emotions, we are using logos.

Logical arguments include things like data, statistics, and common sense.

The main goal of ethos is to establish our credibility so that we can speak on any subject. It refers to persuading someone of the veracity of the one doing the persuading.Logos entails appealing to logic in generally and attempting to persuade through argument.Pathos entails attempting to move the audience's emotions in order to persuade them.

Therefore, the greatest strategy for convincing your friend to join you on a run in rain will be to try to emotionally appeal to them.

To know more about the ethos, pathos and logos, here

https://brainly.com/question/1960396

#SPJ1

In 2003, Congress passed laws to encourage private charitable organizations to provide social services. They would compete for government funds to carry out community services through their own networks. Do you think this is an effective way to address social issues? Why or why not? Use economic concepts, such as markets, efficiency, and opportunity costs in developing your response.

Answers

There are both proponents and opponents of the idea of using private charitable organizations to provide social services that are funded by the government. Some people argue that this approach can be an effective way to address social issues, while others believe that it is not the best approach.

One argument in favor of using private charitable organizations to provide social services is that it can lead to increased efficiency. Private organizations may be able to provide services more efficiently than the government, because they have the ability to be more flexible and responsive to the needs of the community. This can result in cost savings for the government, as well as better outcomes for the people receiving the services.

Another argument in favor of this approach is that it can encourage innovation and competition among different organizations. By creating a market for social services, the government can incentivize organizations to come up with new and innovative ways to solve social problems. This can lead to more effective solutions and better outcomes for the community.

However, there are also some arguments against using private charitable organizations to provide social services. One concern is that these organizations may not be accountable to the same standards as the government, and may not be as transparent in their operations. In addition, there is the potential for conflicts of interest to arise if the organizations are relying on government funding to support their operations.

Overall, whether or not using private charitable organizations to provide social services is an effective way to address social issues depends on the specific context and the goals of the program. It is important to consider the potential benefits and drawbacks of this approach, and to carefully evaluate its effectiveness in achieving the desired outcomes.

Why does the Constitution create limited executive powers? 2 sentences

Answers

Answer:

To make sure that the President does not become too powerful.

Explanation:

what is the opportunity cost is noise pollution

Answers

Declines in property values for residential areas range from 0.4 to 1.1% per decibel, with an average value of 0.62%

If the Antartic (66.5°North) experience six months of daytime during summer,what does the Arctic(66,5°South) experience during winter?

Answers

If the Antartic (66.5°North) experience six months of daytime during summer, the artic would experience six times of night time in winter.

What is the experience of the artic?

The Arctic (66.5° North) experiences six months of nighttime during winter.

The Earth's rotation on its axis causes the phenomenon of day and night, and the tilt of the Earth's axis causes the seasons. The Arctic Circle is located at 66.5° North latitude, which is the latitude above which the sun does not rise for at least one day during the winter solstice and does not set for at least one day during the summer solstice.

This means that during the winter months, the Arctic Circle experiences long periods of darkness or "polar night", while during the summer months, the Arctic Circle experiences long periods of daylight or "midnight sun."

Read more on the artic here: https://brainly.com/question/964879

#SPJ1

EACH QUESTION YOU ANSWER CORRECTLY = 8 POINTS!

1.What is most likely to happen during weathering?

2. A limestone plateau has no surface water. All the water is pulled underground through cracks and crevices in the surface. What most likely will cause the underground of the plateau to change over time?

3. Which method of heat transfer can take place without matter?

4. What type of heat transfer takes place when a furnace heats up an entire room?

5. Two objects of the same mass are in a room. At which of the following distances will the greatest gravitational force be exerted by one object on another?

6. What type of forces causes changes in motion?

7. What type of force is gravitational force?

Answers

Answer:

Explanation:

During weathering, rocks and minerals are broken down and worn away by the action of natural forces such as wind, water, ice, and temperature changes.

Over time, the underground of the limestone plateau is likely to change due to the process of dissolution. This occurs when water moves through cracks and crevices in the surface and dissolves the limestone, creating underground caves and channels.

The method of heat transfer that can take place without matter is radiation. This occurs when heat is transferred through electromagnetic waves, such as infrared radiation.

The type of heat transfer that takes place when a furnace heats up an entire room is convection. This occurs when heat is transferred through the movement of fluids or gases, such as air.

The greatest gravitational force will be exerted by one object on another when they are at the shortest distance.

Forces that cause changes in motion are called external forces.

Gravitational force is a type of force that arises from the interaction between masses. It is the force that attracts objects with mass towards each other.

4. Compared to the
countries that
controlled the spheres
of influence in China,
how strong was
China's economy and
military during this
time?

Answers

Answer: All the european countries who had controlled the spheres of influence in china are struggling foe economic power and causing a rise of tension.

Explanation: when countries likeJapan, Germany, Great Britain, France, and Russia all acquired spheres of influence in China. America looked up for an opportunity to boom the market by making china a manufacturing hub. China makes and sells more manufacturing goods than any other country on the planet.

All the European countries who had controlled the spheres of influence in China are struggling for economic power and causing a rise of tension. While China makes and sells more manufacturing goods than any other country on the planet.

Why did European countries establish spheres of influence in China?

The spheres of influence in China were established to make money for the European powers, such as Russia, Great Britain, and France. Warlords of provinces in China set up arrangements allowing these nations to mine, trade, or build railways.

They granted exclusive trading rights to these foreign states in certain areas of China, allowing them to control parts of the Chinese market.

Learn more about European, here:

https://brainly.com/question/1683533

#SPJ1

In Inside Confederate Headquarters, what does Lee consider to be MOST dangerous to the Confederate cause?
A
a lack of military intelligence

B
low morale among the troops

C
diminishing provisions

D
a shortage of troops

Answers

The lack of military intelligence was the issue the confederates had in the war. Option A

Why the confederates lacked intelligence

A lack of military intelligence is considered to be the most dangerous to the Confederate cause, according to Inside Confederate Headquarters by J. William Jones.

The book is a collection of letters, diaries, and other primary sources that provide insight into the inner workings of the Confederate government during the American Civil War. In the book, General Robert E. Lee, the commander of the Confederate Army, expresses his concern about the lack of accurate and reliable information about the movements and intentions of the Union army.

He believed that this lack of intelligence put the Confederate cause at a significant disadvantage and hindered their ability to effectively plan and execute military operations.

Read more on confederates here: https://brainly.com/question/951920

#SPJ1

ANSWER FAST! DEADLINE IS 10:40! 1ST PERSON TO ANSWER GETS BRAINIEST, 5 STARS, AND THANKS! IF I AGREE SO MUCH, I MIGHT GIVE YOU AN EXTRAA 10 POINTS!

1.Use complete sentences to explain how global wind patterns such as the prevailing westerlies in the northern hemisphere would be impacted if the rotation of Earth stops.

2.Imagine there were no oceans on Earth. How would this impact climates? Use complete sentences to explain your answer.

Answers

Answer:
1. The hotter side wouldn't be windy it would drought
2. It would be dryer and hotter like mars
Explanation:
One side would grow cold meaning more wind possibly starting to snow the other would experience drought possibility of death in both scenarios.

Logical reasoning cannot be learned or improved. Individuals are either naturally good at it or they are not.

Answers

The claim that logical reasoning cannot be taught or improved upon is untrue. Either people are good at it naturally, or they are not. Hence, the statement is false.

What is logical reasoning?

Induction and abduction are two categories of logical reasoning that are frequently distinguished in addition to formal deduction. Using a predetermined set of facts or data to infer other facts through logical deduction is known as deductive reasoning. It entails deriving particular conclusions from premises.

These three categories of thinking can be explained as follows within the framework of a mathematical model. The building/creation of the model's structure is abduction. Induction is the process of giving values (or probability distributions) to the model's parameters. Deduction occurs during model execution.

Learn more about logical reasoning, from:

brainly.com/question/1807373

#SPJ1

Your question is incomplete, probably the complete question is-

Logical reasoning cannot be learned or improved. Individuals are either naturally good at it or they are not.

TrueFalse

How are the provisions in the constitution of Nepal regarding cast and gender discriminations? Present some consultation.​

Answers

ANTI-DISCRIMINATION PROVISIONS IN NEPAL'S CONSTITUTION

The Constitution of Nepal, which was adopted in 2015, prohibits discrimination on the basis of caste, ethnicity, religion, gender, and other grounds. Article 11 of the Constitution states that "no person shall be discriminated against on grounds of race, sex, language, religion, political or other opinion, origin, caste, tribe, profession, or profession, or physical, mental, or intellectual disability."

Article 12 of the Constitution further guarantees the right to equality and non-discrimination, stating that "all citizens shall be equal before the law, and there shall be no discrimination among them on grounds of religion, race, caste, tribe, sex, origin, ideology, or geographical region."

In addition, the Constitution specifically addresses the issue of gender discrimination. Article 18 guarantees the right to equality between men and women, and Article 42 prohibits discrimination against women in employment, education, and other areas. The Constitution also establishes a National Women's Commission to promote the rights of women and to ensure the protection of their interests.

To conclude, the Constitution of Nepal contains strong provisions against discrimination on the basis of caste, ethnicity, religion, and gender, and it sets out the obligations of the state to protect the rights of all citizens and ensure their equality before the law.

Hope This Helps You!

The Constitution of Nepal, which was adopted in 2015, prohibits discrimination on the basis of caste, ethnicity, religion, gender, and other grounds.

Article 11 of the Constitution states that "no person shall be discriminated against on grounds of race, sex, language, religion, political or other opinions, origin, caste, tribe, profession, or profession, or physical, mental, or intellectual disability."

Article 12 of the Constitution further guarantees the right to equality and non-discrimination, stating that "all citizens shall be equal before the law, and there will be no discrimination amongst them on grounds of religion, race, caste, tribe, sex, origin, ideology, or geographical region."

In addition, the Constitution specifically addresses the issue of gender discrimination. Article 18 guarantees the right to equality between men and women, and Article 42 prohibits discrimination against women in employment, education, and other areas. The Constitution also establishes a National Women's Commission to promote the rights of women and to ensure the protection of their interests.

To conclude, the Constitution of Nepal contains strong provisions against discrimination on the basis of caste, ethnicity, religion, and gender, and it sets out the obligations of the state to protect the rights of all citizens and ensure their equality before the law.

To know more about gender discrimination,

https://brainly.com/question/9873909

in which types of government can citizens make their voices heard by voting in elections? Selecet two options
A: Fascist Governments
B: Dictatorships
C: Totalitarian Governments
D: Direct Democracies
E: Representative Democracies

Answers

Types of government in which citizens can make their voices heard by voting in elections are:

D: Direct Democracies

E: Representative Democracies

Explanation:

A: Fascist Governments: a social structure where citizens cannot dissent from the government and where a dictatorial authority controls every aspect of their existence.

Consequently, residents are unable to express themselves through election voting.

B: Dictatorships: A dictatorship is a form of governance in which the dictator or his/her party has total control. This denotes total control in the hands of the monarch or party.

In a dictatorship, the rights of the people are often severely restricted.

C: Totalitarian Governments: A kind of government known as totalitarianism aims to have complete control over the lives of its people. A strong central rule that uses force and repression to try to manage and control every area of a person's life is what distinguishes it.

Individual freedom is not allowed.

D: Direct Democracies: A system of governance where laws and policies are chosen by a majority of all eligible voters rather than by a body of elected representatives.

Voting in elections allows residents to share their opinions.

E: Representative Democracies: Representative democracy is a kind of democracy in which people elect representatives who then vote on those proposals.

Citizens make their voices heard by voting in elections

Therefore types of government in which citizens can make their voices heard by voting in elections are direct democracies and representative democracies

Learn more about types of government here:brainly.com/question/30132184

what is an example of a participant
observation?

Answers

An example of participant observation is when an anthropologist spends time living with a tribe in order to gain a better understanding of their culture and customs.

What is participant observation?

Participant observation is an approach to social research that involves a researcher observing and participating in the activities of a group. This type of research is used to gain an understanding of how people interact within their social environment. The researcher typically gathers data by observing the group’s activities, taking notes, and interviewing members of the group. Participant observation allows the researcher to gain a more holistic understanding of the group and its members than traditional survey methods. This method of research also allows the researcher to form a more personal connection with the participants, as well as to better understand the context of the group’s activities.

The anthropologist would be participating in the tribe's activities and observing their behavior and interactions, while also taking notes and interviewing members of the tribe.

To learn more about participant observation
https://brainly.com/question/14619255
#SPJ1


the powers of government are
divided?

Answers

Yes, if you are talking about the United States of America government it’s divided into 3 parts: legislative, judicial, and executive.

Your question is a little confusing but I hope this helps!!

25 Points! Hurry! Please help! I provided a screenshot of my question. Thank you!

Answers

Answer:

it can either be C or D I will most likely say D

Explanation:

If you see on the map, the Arabian Sea has more 80°-90°F

What is another name for an oval-shaped projection map?

Answers

The Robinson projection is another name for an oval-shaped map projection. Arthur Robinson invented the Robinson projection map in 1963, and National Geographic used it from 1988 to 1998.

What is an oval map?

A method to assist a group of people in figuring out their ideas surrounding an issue is oval mapping. They are a fantastic way to engage people in conversation and help them organize their thoughts, whether you choose to use a formal methodology or just use the ovals casually.

In the late 16th and early 17th centuries, world maps primarily used the Ortelius oval projection. It tries to present a compromise rather than being either conformal or equal-area.

Therefore, The Robinson projection is another name for an oval-shaped map

To Learn more about maps from the given link.

https://brainly.com/question/19130581

#SPJ1

A federal government is best illustrated by Responses
A Spain.Spain.
B Japan.Japan.
C The United Kingdom.The United Kingdom.
D United States of America.United States of America.
E The European Union.The European Union.

Answers

The correct answer is D.

based on what you know about ancient greece, why is it significant that philosopher Aristotle might have originated the term state

Answers

Aristotle contends that a constitution governed by a sizable middle class is the greatest option for city-states that fall short of the ideal.

Why is Aristotle a significant individual in ancient Greek history?

Aristotle laid the foundation for a lot of modern scientific knowledge, including the categorization of objects and living things. His four-element theory of nature (i.e., minerals, plants, animals, and people) has aided biologists for ages while being incorrect by modern standards.

He founded the field of formal logic, made groundbreaking contributions to all areas of philosophy and science, and recognized and examined the connections between the numerous scientific disciplines. In addition to being a philosopher, Aristotle was a teacher who established the Lyceum in Athens.

Learn more about Aristotle, here:

https://brainly.com/question/5399979

#SPJ1

In "The Philosophy of the Manufacturers" by Andrew Ure, the author compares a factory worker to a handmade
worker. The author leads the reader to the idea that the factory worker is better off. Choose evidence (a quote
from the text) to support this idea.

a. Certainly no muscular fatigue to sustain, while it procures for him good, unfailing wages, besides a
healthy workshop gratis.
b. The lot of mankind, have been too little dwelt upon; while, on the other har, it has been accused of
lending itself to the rich capitalists as an instrument for harassing the poor.
c. The principle of the factory system then is, to substitute mechanical science for hand skill, and the
partition of a process into its essential constituents.

Answers

Option d is the correct answer. The author of "The Philosophy of the Manufacturers," Andrew Ure, compares a factory worker to the system that eliminates competent humans and replaces them with machines.

How does Andrew Ure defend the factory system?

Since it relieves them of most of the monotony associated with producing items by hand, he contends that the new factory system is advantageous to workers. He also mentions that skilled workers are replaced by machines under the system, which eliminates them.

When Ure wrote his book, he was largely discussing textiles yarn and fabric but his principles apply to other industries as well. In his view, people who work in factories would in some ways become a part of a mechanical process for producing commodities. Many business owners at the time agreed with his perspective.

To know more about Andrew Ure, visit:

https://brainly.com/question/27939716

#SPJ1

what are some possible solutions where both Serbia and kosovo are satisfied with kosovo’s pursuit of self determination?

Answers

Answer: The situation between Serbia and Kosovo is complex and there are no easy solutions that would satisfy both sides. However, some possible options that have been discussed in the past include:

Federated solution: This would involve Kosovo being granted significant autonomy within Serbia, while still being recognized as part of the country.

Confederation: Under this arrangement, Kosovo and Serbia would form a confederation, with both countries retaining their own sovereignty and autonomy, but also being linked through a loose political union.

Independence: Kosovo could be granted independence, with Serbia recognizing Kosovo as a sovereign state.

International mediation: An international mediator or mediators could be brought in to facilitate negotiations and help find a mutually acceptable solution.

Ultimately, any solution will need to take into account the concerns and interests of both Kosovo and Serbia, and find a way to balance the right of Kosovo to self-determination with Serbia's desire to maintain its territorial integrity.

Answer:

Possible solutions where both Serbia and Kosovo are satisfied with Kosovo's pursuit of self-determination include a negotiated settlement between the two parties, a mutually agreed upon referendum, or a third-party mediated agreement.

Explanation:

Achieving a comprehensive normalization of relations between Kosovo and Serbia is necessary for the region's long-term peace, security, and stability. With efforts having failed to achieve a settlement agreeable to both parties, dynamics turned inwards towards effectuating a claim to external self-determination through unilateral secession. The two sides have agreed to the principles of sovereignty and territorial integrity, with the ethnic Albanians of Kosovo wanting independence, or at least a referendum on self-determination.

What is the catch-all term for students who require intervention in order to meet minimum academic goals?

A.
at-risk student

B.
special needs student

C.
AP student

D.
stunted student

Answers

Answer:

A. at-risk student is the answer.

Explanation:

Answer: The catch-all term for students who require intervention in order to meet minimum academic goals is "at-risk student."

Explanation:

The catch-all term for students who require intervention in order to meet minimum academic goals is "at-risk student." This term refers to students who face challenges that may hinder their academic success and may need additional support or intervention. At-risk students are not the same as special needs students, who have disabilities that require special education services, or AP students, who are enrolled in advanced placement courses.

MACROECONOMICS
1. What are the basic questions economists must answer when they are evaluating an economic policy (public policy)?

2. Is it common for marginal costs to increase and marginal benefits to decrease? Think about a simple activity you can practice (for instance, eating 1,2, 3...20 chocolates; or drinking 1,2,3, and 4 water bottles when you are thirsty; or repeat 1,2,3,4 times the same sport practice in a day after school). What is marginal benefit from the first, second, and third practices for the activity in a day? What is marginal cost from the first, second, and third practices for the activity in a day? Hint: It is important to remember that cost and benefits are not strictly financial.


3. Is it rational for some people to end their formal education with high school degrees, some to finish with college degrees, and some to obtain graduate degrees? Beyond the ability to pay tuition, what are some other reasons why different people stay in school for different lengths of time? How might the non-monetary cost of college differ among individuals? How might the benefits differ?

Answers

Public policies are assessed based on their viability for implementation and the efficiency and fairness of their intended outcomes.

What is an economic policy?

Governments utilize a variety of strategies to manage their economies, which are referred to as economic policies. These include fiscal policy, budgeting, taxation, and monetary policy (money supply and demand).

The majority of economic policy elements fall into one of two categories: monetary policy, which deals with central bank activities related to the money supply and interest rates, or fiscal policy, which deals with government actions related to taxation and spending.

Yes it is common for marginal costs to increase and marginal benefits to decrease.

Relationship between marginal cost and marginal benefit

The most a consumer will spend on one additional commodity or service is known as the marginal benefit. The marginal benefit typically declines with consumption. The difference in cost for producing one extra good or additional unit of service is known as the marginal cost of production.

Yes, it is rational for most people to go ahead and acquire more degrees, while others end up with high school degrees.

The non monetary cost of college will further increase the total number of individuals who will further their studies due to ease in economic strain of tuition.

Learn more on economic policy here https://brainly.com/question/30104788

#SPJ1

Other Questions
Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10 2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each year, try to capture as many moths as you can. When you are done, select the TABLE tab and record the percentages of each moth type. Year Dark moths Light moths o 1 2 3 4 5 What was Hale's purpose in the play? What is the smallest positive multiple of $13$ that is greater than $500?$ Complete this table so it shows a relation that is not a function.X2-4-3y317-5 Which saint is buried at Durham Cathedral? Cara has been outside in humid weather for about five minutes. Her body can tell that the temperature has increased. Describe what her body might begin to do in order to maintain homeostasis while Cara is gardening in the heat. How do these changes help Caras body adapt? A 62-year-old man who has had a worsening cough for several months now complains of dyspnea. He also has fatigue and has experienced a 15-lb weight loss. A chest radiograph shows hilar lymphadenopathy and a right lung mass.What other studies might be helpful in arriving at a definitive diagnosis?What are the risk factors for tumors of the lung? Mg + _________HCI _____ H + _____ MgCh How do you find the two missing sides of an acute triangle?