What would a developer do to update a picklist field on related Opportunity records when a modification to the associated Account record is detected

Answers

Answer 1

Answer:

Create a process with Process Builder.

Explanation:


Related Questions

A massively large database that contains current facts about all kinds of world activities is called _________

Answers

The term "Freebase" refers to a colossally sizable database that contains up-to-date information about all manner of global activities.

In a big data scenario, which database is frequently used?

A data lake is frequently where big data is kept. Data lakes are often based on Hadoop clusters, cloud object storage services, NoSQL databases, or other big data platforms, whereas data warehouses are typically built on relational databases and only hold structured data.

A large database size is what?

Although this definition inevitably varies over time, the most typical definition of a VLDB is a database that is more than 1 terabyte in size or has several billion rows.

To know more about Freebase visit :-

https://brainly.com/question/28901682

#SPJ4

A workstation at work is found to be unsecured. The account used on the computer does not have a password, the data is not encrypted, and the computer itself is located in an area with easy access. This particular workstation contains personal information about its customers. In regards to the regulation of data, which is being compromised?
A) PII
B) PHI
C) PCI
D) GDPR

Answers

PII is being compromised Any representation of information that permits the identity of an individual to whom the information applies to be reasonably inferred by either direct or indirect means.

What is meant by Encryption of data?Data encryption is a technique for converting plaintext (unencrypted) data to ciphertext (encrypted). The use of an encryption key and a decryption key allows users to access encrypted and decrypted data, respectively. Significant volumes of private data are managed and kept online, either on servers connected to the cloud. Sensitive information should be protected from hackers via encryption, which is a key strategy for both individuals and businesses. Websites that transmit credit card and bank account details, for instance, encrypt sensitive data to guard against fraud and identity theft. Data encryption changes plaintext data from a readable format to ciphertext, an unreadable format. Only once the data has been decrypted may users and processes read and use it. The decryption key needs to be secured against unwanted access because it is confidential.

To learn more about PII  refer to:

https://brainly.com/question/29829548

#SPJ4

To move a chart to a different worksheet, click on the Chart > Chart Tools > Design tab > Location group > Move Chart > New sheet, and then in the New sheet box, type a name for the worksheet. (T/F)

Answers

To move a chart to a new worksheet, use the Chart > Chart Tools > Design tab > Location group > Transfer Chart > New sheet button. Next, confirm that the statement that is provided in the New sheet box is accurate.

Worksheet? Why do you say that?

Data may be entered and calculated in the cells of a worksheet, which is also known as a spreadsheet. The cells have been set up in columns and rows. A worksheet is always preserved in a workbook.

What is the purpose of a worksheet in a classroom?

Worksheets are frequently unbound sheets of paper that include exercises or questions that students are required to complete and record their answers to. They are used to some extent in most classes, but they are most common in math classes, where there

To know more about worksheet visit:

https://brainly.com/question/13129393

#SPJ4

6. A Salesforce user at Universal Containers has been deactivated. What will happen to the records the user owns in Salesforce

Answers

For the records, ownership will remain unchanged. Still, the inactive user will be linked to records.

How is the linked license handled when a user account is deactivated?

The number of user licenses available to your organization is not affected by a deactivated user. However, deleting a user doesn't affect how many licenses your company is charged for. You must alter the license count for your company in order to alter billing.

Are accounts that have been deactivated deleted?

When you deactivate an account, it is not completely deleted. In the event that you decide to reactivate your account, F acebook keeps all of your preferences, pictures, and information when you deactivate your account. Your data is still there; it's just buried.

To know more about ownership visit :-

https://brainly.com/question/14480423

#SPJ4

Which of the following network devices would MOST likely be installed to allow a fiber optic cable
to be plugged into a network device with only RJ-45 connections?
A. WAP
B. Basic switch
C. Hub
D. Media convertor

Answers

The network devices that would MOST likely be installed to allow a fiber optic cable to be plugged into a network device with only RJ-45 connections is D. Media convertor.

A media converter is a device that allows different types of communication media, such as copper and fiber optic cables, to connect to each other. In this case, a media converter would be used to allow a fiber optic cable to be plugged into a network device that has only RJ-45 connections, which are typically used for copper cables. The media converter converts the signals from the fiber optic cable to the signals that can be transmitted over copper cables. This allows devices that are connected to the network using copper cables to communicate with devices that are connected to the network using fiber optic cables.

Learn more about media installation here, https://brainly.com/question/30149240

#SPJ4

Benchmark tests on competing products can be used to select ____. a. primarily hardware products b. primarily software products

Answers

It is possible to utilize benchmark testing to assess both software and hardware items. The greatest product reviews in technology journals assess multiple goods against predetermined criteria and list the benefits and drawbacks of each product.

What is benchmarking?

Comparing company operations and performance metrics to industry benchmarks and other companies' best practices is the process of benchmarking. Quality, time, and money make up the three key measures.

Using a certain indicator (such cost per unit of measure, productivity per unit of measure, or cycle time of x per unit of measure,

Benchmarking is a technique for measuring performance that generates a metric of performance that is then compared to others (such as faults per unit of measure).

This management technique, usually referred to as "process benchmarking" or "best practice benchmarking,"

compares a variety of operational characteristics of an organization to best-practice firms, usually within a peer group created for the purpose of comparison.

Hence , It is possible to utilize benchmark testing to assess both software and hardware items.

learn more about benchmark click here:

https://brainly.com/question/5561623

#SPJ4

Match the different stages of the boot sequence with the order in which they occur. 1 . Second The computer performs a power-on self-test (POST). 2 . Fifth The boot loader takes control of the computer, loads the operating system into memory, and launches it. 3 . Sixth BIOS confirms that it found the boot loader and loads the program into the RAM on the motherboard. 4 . First The computer displays the details of the process. 5 . Third BIOS accesses the first sector of the boot disk. 6 . Fourth The power button turns on the power and sends it to the motherboard and other components.

Answers

The computer performs a power-on self-test (POST) is the second step.

What are the the different stages of the boot sequence ? The operating system is loaded into memory by the bootstrap loader, also known as the boot loader, allowing it to start working. The bootstrap loader configures the tiny driver programmes that communicate with and manage the different hardware components of the computer in their most basic form.The sixth stage is when the boot loader takes over the computer, puts the operating system into memory, and starts it.First, the electricity is turned on and sent to the motherboard and other components by pressing the power button.The third phase is when the computer shows the process's specifics.The fourth step involves BIOS accessing the boot disk's first sector.

To learn more about  boot loader refer to:

https://brainly.com/question/13258563

#SPJ4

Match the type of system to the application. Maintaining the temperature in a manufacturing plant Answer 1 Choose... Air conditioning single-family homes Answer 2 Choose... Air conditioning high-rise office buildings Answer 3 Choose...

Answers

The type of system and application,

Homes: Residential

Office buildings: Commercial

Manufacturing plant: Industrial

What kind of system is designed to distribute air around a building and resupply oxygen?

The process of exchanging or replacing air in any place to provide excellent indoor air quality comprises regulating temperature, replenishing oxygen, and removing moisture, smells, smoke, heat, dust, airborne bacteria, carbon dioxide, and other gases. This is known as ventilation (the "V" in HVAC).

Why are water-cooled condensers used by so many central system chillers?

However, not all chillers are effective for use in commercial settings. Because of their superior heat transmission, higher energy efficiency, and longer lifespan, water-cooled chillers are suited. They are frequently employed in big and medium-sized facilities with reliable and effective water supplies.

To know more about manufacturing plant visit:

https://brainly.com/question/14203661

#SPJ4

A customer uses an unencrypted wireless network. One of the users has shared a folder for access by any computer. The customer complains that files sometimes appear and disappear from the shared folder. Which of the following statements best describes how to fix the problem

Answers

A parallel, USB, or wireless interface is typically used by home computers to connect to printers. Network cables or wireless interfaces can be used by printers to connect to a network.

What is Common Printer Features?Serial : Single bits of information are moved in a single cycle through serial data transfer. Since dot matrix printers don't need to transport data at fast speeds, a serial connection can be used.Parallel : It is quicker to transport data in parallel than serially. A single cycle of parallel data transfer allows the movement of multiple bits of data. Data can move more quickly to or from the printer thanks to the broader data transfer path than with serial data transfer.Printers and other devices typically have a USB interface. A plug-and-play-compatible computer system will immediately detect and begin the driver installation process when a USB device is connected to it.FireWire : Platform independent high-speed communication bus called FireWire is also referred to as iLinc or IEEE 1394. Digital printers, scanners, hard disks, and other computing equipment can all be connected via FireWire.

To Learn more About wireless interface Refer To:

https://brainly.com/question/28399168

#SPJ4

A computer program outputs whether a capital city in Europe is north or south of another capital city in Europe. It only needs to know the latitude of the two cities – the other detail is unnecessary. This is an example of abstraction; including the necessary detail and not including the unnecessary detail.

Answers

Program brief :

City = input(“Enter a city in Europe”)Latitude=input(“Enter the Latitude ofthe city”)

If Lattitude ==

You must analyze data on a digital camera's internal memory. You plan to connect your forensic computer to the camera using a USB cable. What should you do to ensure that you do not modify data on the camera

Answers

A read-only device known as a forensic disk controller or a hardware write-blocker enables users to access the data on a questionable device without running the risk of changing or destroying the data.

What initial care should be taken with a mobile device to protect data?

The easiest approach to handle a mobile device and protect data is to keep it powered on while enclosing it in a Faraday cage.

What program is used to image a disk for forensic purposes?

The Autopsy and the Sleuth Kit are probably the two most well-known forensics toolkits. The Sleuth Kit is a command-line tool that does forensic examination of hard drive and smartphone forensic photos.

To know more about forensic disk visit:-

https://brainly.com/question/9692470

#SPJ4

Access is a database management system software that allows you to use a computer to create a database; add, change, and delete data in the database; create queries that allow you to ask questions concerning the data in the database; and create forms and reports using the data in the database. True or false

Answers

An introduction to the structure of an Access database is given in this article. You can utilize the various tools that Access offers to get acquainted with it true.

What purposes does Access database serve?

With the aid of the robust database program Access, you can manage and keep track of a lot of data. To assist you in making wiser business decisions, Access makes it simple to build personalized reports and forms.

Is Access a program for managing databases?

Microsoft Access is a well-known database management system produced by Microsoft and a part of the Microsoft 365 office suite. The relational Jet Database Engine, software development tools, and a graphical user interface are all included with Microsoft Access (GUI).

To know more about Access database visit:-

https://brainly.com/question/29982215

#SPJ4

Which of the following is NOT among the items of information that a CVE reference reports?
1. Attack Signature
2. Name of the vulnerability
3. description of vulnerability
4. Reference in other databases

Answers

Attack Signature is not among the items of information that a CVE reference reports.

Describe a database.

Any type of data can be stored, maintained, and accessed using databases. They gather data on individuals, locations, or objects. It is collected in one location in order for it to be seen and examined. You might think of database as a well-organized collection of data.

Excel: Is it a database?

Spreadsheet software, not a database, is Excel. Its restrictions in that sense are significant, despite the fact that many users attempt to force it to behave like a database. Let's start with the most obvious: unlike databases, Excel is not constrained to 1M rows of data.

To know more about database visit :

https://brainly.com/question/25198459

#SPJ4

Your organization uses Windows desktop computers. You need to implement an efficient solution for deploying updates to the Windows computers. What should you deploy

Answers

When a practical method for distributing updates to Windows computers is required, use Windows Deployment Services.

In which of the following services does WSUS engage?

WSUS makes use of seven services. Update Service (wsusservice.exe), Reporting Web Service, API Remoting Web Service, Client Web Service, Simple Web Authentication Web Service, Server Synchronization Service, and DSS Authentication Web Service are among them.

What security protocol will you choose to encrypt web traffic from the list below?

The principal protocol for transmitting data between a web browser and a website is hypertext transfer protocol secure (HTTPS), which is HTTP. To improve data transfer security, HTTPS is encrypted.

To know more about Windows Deployment Services visit :-

https://brainly.com/question/28874539

#SPJ4

You are the security administrator for an enterprise that follows the bring your own device (BYOD) deployment model. What is the first action that you should take to protect sensitive enterprise data from exposure if an employee device is stolen and can't be located

Answers

You should perform a remote wipe to protect sensitive enterprise data from exposure if an employee device is stolen and can't be located.

What exactly are remote lock and wipe?

Terms like "remote wipe" and "remote lock" are frequently used in the business to describe managing mobile devices like laptops, desktop computers, tablets, smartphones, and more (MDM).

A stolen laptop can it be remotely erased?

Your Windows laptop can also be remotely erased. Prior to this occurring, confirm that the Find My Device feature is turned on: Authenticate using your Microsoft account. In Windows 10, make sure the feature is turned on by going to Settings > Update & Security > Find my device.

To know more about remote wipe visit

brainly.com/question/10316119

#SPJ4

You are configuring a wireless access point for the office you work in. You are configuring both 2.4 GHz (Gigahertz) and 5 GHz for users. Which wireless standard will only use the 5 GHz spectrum

Answers

The wireless standard that uses only the 5 GHz spectrum is IEEE 802.11ac. It is a faster and more recent standard than IEEE 802.11n, which can use both 2.4 and 5 GHz spectrums.

The 2.4 GHz spectrum is a lower frequency than the 5 GHz spectrum and has a longer wavelength, which means it can better penetrate walls and other obstacles. However, it also means that there is more interference from other devices that use the same spectrum, such as microwaves and Bluetooth devices. The 5 GHz spectrum, on the other hand, has a shorter wavelength and is less likely to be affected by interference but has a more limited range. Wireless standards such as IEEE 802.11n and IEEE 802.11ac are developed to take advantage of the properties of different frequency spectrums to provide faster and more reliable wireless connections.

Learn more about wireless, here https://brainly.com/question/30087574

#SPJ4

Your primary e-mail server uses three hot-swappable hard disks in a RAID 5 configuration. When one disk fails, other disks are readily available in the server room, which you can simply plug in while the server is still running. Which term best describes this scenario

Answers

Hardware fault tolerance is the term best describes this scenario.

In functional safety, what does HFT mean?

The HFT refers to a system's capacity to carry out the necessary safety function despite one or more hardware defects. The ratio between a system's safe failure rate and its overall failure rate is known as the SFF.

Which fault tolerance types are there?

A fault-tolerant system may be able to withstand one or more types of failures, such as: I transient, intermittent, or permanent hardware problems; ii) mistakes in the software and hardware design; iii) human mistakes; or iv) externally generated upsets or physical damage.

To know more about fault tolerance visit

brainly.com/question/14927034

#SPJ4

A company wants to use Amazon Elastic Container Service (Amazon ECS) to run its containerized applications. For compliance reasons, the company wants to retain complete visibility and control over the underlying server cluster. Which Amazon ECS launch type will satisfy these requirements

Answers

To run its containerized apps, a business wants to use Amazon Elastic Container Service (Amazon ECS). The business desires to keep for compliance-related reasons.

Which AWS solution enables the launching of Docker containers on AWS but necessitates the provisioning and upkeep of the infrastructure?

You may simply execute apps on a cluster of Amazon Elastic Compute Cloud (Amazon EC2) instances with the help of Amazon Elastic Container Service (ECS), a highly scalable, high performance container management service that supports Docker containers.

What service is employed by AWS mcq to run containerized applications?

AWS' fully managed container orchestration solution makes it simple to deploy, control, and scale containerized applications.

To know more about Amazon ECS visit:-

https://brainly.com/question/28414984

#SPJ4

Which of the following is not one of the three defining characteristics of a portal? A) commerce B) content C) auctions D) navigation of the Web

Answers

The three fundamental features of a portal do not include auctions. The three defining virtues of portals are personalisation, consistency, and integration.

What is the portal's architecture?

Architecture is the art and technique of designing and building, as opposed to the skills associated to construction. Drawing, imagining, planning, designing, and building are all procedures that go into the creation of buildings and other structures.

What role does the portal play?

Clients can easily access pertinent information via portals, including FAQs, troubleshooting advice, company and product data, and much more. This data is accurate and current thanks to well-managed portals. Major general portals include AOL.com by America Online, Yahoo, Excite, Netscape, Lycos, CNET, and Microsoft Network.

To know more about portal visit:-

https://brainly.com/question/29315516

#SPJ4

How can perfection be attained on sync?​

Answers

Perfection can be attained by practicing anything. Perfection on sync can be attained by using and knowing its every function.

What is sync?

In computers, synchronization (or syncing, sync) is the process of constantly guaranteeing that data in one location is an identical clone of data in another location.

When you press the "sync" button, the device transfers data from your phone to the service's servers. If you swap phones and your new phone has Syncing capabilities, you can restore your contacts and documents to the phone.

Therefore, anything can be practiced to achieve perfection. Perfection on sync can be obtained by using and understanding all of its functions.

To learn more about sync, refer to the link:

https://brainly.com/question/19501147

#SPJ1

Codewriting Python 3 main.py3 Saved def solution (blocks, height): You are given array of integers called blocks . Each of the values in this array represents the width of a block - the ith block has a height of 1 and a width of blocks[i] (i.e. it's a 1 x blocks (1) block). You want to pack all the given blocks into a rectangular container of dimensions height x width , according to the following rules: . Place blocks into the container row by row, starting with block . For each row, place the blocks into the container one by one, in the order they are given in the blocks array. • If there is not enough space to put the current block in the current row, start filling the next row. You are given the value height of the rectangular container. Your task is to find the minimal possible width of a rectangular container in which all blocks can fit. Find and return this minimal possible width value. TESTS CUSTOM TESTS RESULTS O RUN TESTS NOTE: The blocks cannot be rotated. A Tests passed: 0/26. Syntax error. Example Test 1 . For blocks - [1, 3, 1, 3, 3] and height - 2. the output should be solution (blocks, height) - 6 Input: blocks: [1, 3, 1, 3, 3] height: Here's how the blocks should be packed in a container size 2 X6 6 Expected Output: LILL-HD-T.

Answers

The minimal possible width of a rectangular container in which all blocks can fit is print(solution([1, 3, 1, 3, 3], 2))     #test case

def solution(blocks, height):       #function definition

   width = max(blocks)         #at first width is initialzied with max width of block in blocks list

   while(1):       #loop repeats until correct width is found

       temp = []   #list to store the blocks that are placed succesfully

       x = []  #a list of size height is declared to store the blocks of each row

       for i in range(height):

           x.append(0)     #fill the list x with zeroes

       j = 0               #j is initialzied to zero

       for i in range(len(blocks)):    #for each block present in blocks list

           if(x[j] + blocks[i] <= width):  #if current block can be placed in jth index

               x[j] += blocks[i]       #then it is added

               temp.append(blocks[i])  #and as it is added to x, we can add that to temp also

           else:       #else

               j += 1  #go for next index i.e., increment j by 1

               if(j < len(x) and (x[j] + blocks[i] <= width)): #check if current block can be placed

                   x[j] += blocks[i]       #adds that to x

                   temp.append(blocks[i])  #and to temp also

               else:       #else if the capacity of rectangle exceeds

                   width += 1  #we increase the width by 1 and continue the above process again

                   break       #break from this for loop

       if(len(temp) == len(blocks)):   #whenver temp and blocks are same, all blocks are placed succesfully

           break   #then we break from the while loop

   return width    #width is returned

print(solution([1, 3, 1, 3, 3], 2))     #test case

To learn more about Python

https://brainly.com/question/18502436

#SPJ4

Which of the following shows the correct relationship for productivity, outputs, and inputs? a. productivity = (outputs/inputs) b. outputs = (productivity/inputs)

Answers

The correct relationship between productivity, output, and input is: Productivity = (output/input). Productivity indicates how much output can be produced for a given amount of input.

What is productivity and types?

Productivity refers to how much output can be produced with a given amount of input. Productivity increases when the same amount of input produces more output, or when less input produces the same amount of output. He has two widely used productivity concepts.

There are following types of productivity: capital productivity. material productivity. labor productivity. total factor productivity.

What are the main sources of productivity?

There are many factors that affect a country's productivity. These include investment in factories and equipment, innovation, improved supply chain logistics, education, enterprise, and competition.

To learn more about productivity visit:

https://brainly.com/question/17405663

#SPJ4

Which of the following pairs of components constitutes the human side of information systems? A) software and procedures. B) software and people

Answers

The human component of information systems is made up of pairs of components called People and Procedures.

Which of the five parts that make up an information system is the most straightforward to alter?

In terms of organizational disruption and ease of change, describe how the five components of an information system are organised. Data, software, hardware, processes, and people. The easiest things to alter are on the computer side, whereas the most difficult are on the human side. Of the following.

which is a part of an information system?

Hardware, software, databases, networks, and people make up the core components of an information system. To execute input, process, output, feedback, and control, these five elements must work together.

To know more about information systems visit :-

https://brainly.com/question/14688347

#SPJ1

You are creating a DRP for a small, independent car dealership. There are four employees who each use a desktop computer; there are no servers. All company data is stored on the four computers. A single high-speed DSL link is shared by all users. What are the best DRP solutions

Answers

The risks that will have the greatest influence on business operations are identified via a business impact study. In figuring out how to recover from a calamity, this is helpful.

What kind of disaster recovery strategy focuses on minimising the impact of a disaster on IT systems, staff, and customers?

A disaster recovery plan gives companies the ability to react swiftly to a crisis, take immediate action to lessen damage, and restart operations as soon as feasible. Typically found in a disaster recovery strategy are Staff members can use emergency measures in the event of a calamity.

What actions should you take when keeping backup server tapes offsite?

Maintain all of your backup tapes and other media in a safe, comfortable, and, most importantly, fireproof environment. No matter if you backup a single file or a whole system.

To know more about business impact study visit :-

https://brainly.com/question/18645299

#SPJ4

Which of the following lines, if any, contains a valid, though not necessarily accurate, comment? Explain why others are invalid. (In Java in case you were wondering)
a. int twoPi = 2*3.14159; / / *holds the value of 6 //* Valid? Why?
b. int twoPi = 3.14159; /* holds the value of two times pi */ Valid? Why?
c. int twoPi = 2*3.14159; /* holds the value of two times pi //* Valid? Why?
d. double twoPi = 2*3.14159; /* // holds the value of two time pi */ [comment] // Valid? Why?

Answers

Only the final sentence is true: double twoPi = 2*3.14159;

What is Java?

Due to the fact that twoPi is storing pi at 3.14159 after being multiplied by 2. Therefore, the comment is true.

The first sentence's remark is incorrect since the program will fail to compile unless the value is entered as int twoPi = (int)(2*3.14159);

the second statement is also incorrect because pi is never multiplied by 2, hence it is impossible to save pi times its original value.

The final sentence is similarly incorrect since using an int datatype variable to store that value of pi times two would result in a compile-time error.

To know more about Java visit:

brainly.com/question/29897053

#SPJ4

You are working on a project that requires virtualizing an operating system (OS) for an end user to test an application. It has been requested that you use a type-2 hypervisor to accomplish this. Which of the below would fulfill that requirement

Answers

You are need to carry out this task using a type-2 hypervisor. You are engaged in a project that calls for virtualizing the kvm operating system.

What hardware is KVM?

A KVM switch is a piece of hardware that enables a user to operate several computers from one or more sets of keyboards, video displays, and mice. KVM is an acronym for "keyboard, video, and mouse."

Why is a KVM required?

In conclusion, a KVM is a device that enables rapid and simple switching between many PCs or servers from a single console (keyboard, monitor, and mouse configuration) for improved administration, cost- and space-saving, and increased efficiency. A KVM switch is frequently helpful in the following situations: Home Office. Small

To know more about KVM visit:

https://brainly.com/question/13439312

#SPJ4

An operation that copies a value into a variable is called a(n) ________ operation.
a. equals
b. copy
c. declaration
d. cout
e. assignment

Answers

Answer:

e

Explanation:

Which of the following is not an aggregate function that can be applied in a total row?
a. MAX
b. AVERAGE
c. COUNT
d. VLOOKUP

Answers

VLOOKUP is not a aggregation function that can be applied in a total row. Correct option is 'd' .

Aggregate functions perform calculations on a set of values ​​and return a single value. This function ignores null values. Often used in the GROUP BY clause of SELECT statements.

All aggregate functions are deterministic. That is, aggregate functions return the same value each time they are called with a particular set of input values.

SQL does not have all as a built-in aggregate function. Average is used to find the average, MAX is used to find the maximum value and count is used to COUNT the number of values.

For further information regarding aggregate functions, click the link below:

brainly.com/question/28536009

#SPJ4

There is no aggregation function in VLOOKUP.

A single value is returned by aggregate functions after they have performed calculations on a set of values. Null values are ignored by this function. frequently used  the SELECT statements' GROUP BY clause.

They are all deterministic aggregate functions. In other words, when an aggregate function is run with a specific set of input values, it always returns the same result.

All is not a built-in aggregate function in SQL. The terms average, max, and count are used to determine the average, max, the maximum value, and count, the number of values.

To know more about aggregate function, refer:

brainly.com/question/28536009

#SPJ4

A computer user has provided input, and the computer system has completed its processing functions, but the user does not have an immediate use for the information that resulted from the processing. What type of peripheral device might then be used for the next step of the process?

Answers

The following stage of the process might then make use of a peripheral device of the hard disk variety.

What should you do if a computer headset that is connected in isn't functioning properly?

What should you do if a computer headset that is connected in isn't functioning properly? Remove the headset's plug. -Refresh the device driver. - Change the computer's power cable.

Detailed instructions that explain to the computer how to transform data into information?

The software, or the carefully thought out, sequential instructions needed to transform data into information, is what actually makes computers useful. Software categories. In general, software can be divided into system software and applications software.

To know more about peripheral device visit :-

https://brainly.com/question/4297339

#SPJ4

In terms of total dollars spent, the number one and two advertising media are:
A. broadcast and cable television along with direct mail.
B. the Internet and television.
C. television and newspapers.
D. newspapers and radio.

Answers

Broadcast and cable television, along with direct mail, are the top two advertising media in terms of total dollars spent.

The right answer is A.

What distinguishes cable from broadcast media?

Cable stations like Animal Planet, AMC, and Comedy Central don't use the public airwaves like broadcast channels do. Instead, they impose a subscription fee for transmission on viewers. Cable channels are independent businesses that provide all the benefits and drawbacks of demand-driven, independent media.

What is broadcasting on cable?

any broadcast that allows viewers or subscribers to receive radio, television, and on-demand broadcast services through a cable network under DVB-C, DVB-C2, or DVB-IPTV standards using their set-top boxes and integrated TV receivers is referred to as cable broadcasting; Sample

To know more about Broadcast and cable visit:

https://brainly.com/question/8981076

#SPJ4

Other Questions
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10 2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each year, try to capture as many moths as you can. When you are done, select the TABLE tab and record the percentages of each moth type. Year Dark moths Light moths o 1 2 3 4 5 What was Hale's purpose in the play? What is the smallest positive multiple of $13$ that is greater than $500?$ Complete this table so it shows a relation that is not a function.X2-4-3y317-5 Which saint is buried at Durham Cathedral? Cara has been outside in humid weather for about five minutes. Her body can tell that the temperature has increased. Describe what her body might begin to do in order to maintain homeostasis while Cara is gardening in the heat. How do these changes help Caras body adapt? A 62-year-old man who has had a worsening cough for several months now complains of dyspnea. He also has fatigue and has experienced a 15-lb weight loss. A chest radiograph shows hilar lymphadenopathy and a right lung mass.What other studies might be helpful in arriving at a definitive diagnosis?What are the risk factors for tumors of the lung? Mg + _________HCI _____ H + _____ MgCh How do you find the two missing sides of an acute triangle? Is Managua the biggest city in Nicaragua? The school district is served by four buses, each of which delivers students to three different schools. You know the cost of transporting each of the students to each of the schools, and you want to determine the least expensive way to get all of the students to their schools. If you use Excel Solver for this analysis, how many different variable cells should you use? 4 07 12 O 16 Question 21 / 58 submit Jump to unanswered question: A small business celebrates serving 5110 customers in their first year of business how many customers did they average each day Which sentence is incorrect? A. -3 > -8 B. -4 > -7 C. -2/5=0.4 D. -5/2=0.4 If a corporation has an operating margin of profit of 9.50%, this means that for every $1 of revenue, the company has: When you choose not to ask questions, your box will ______________. How does the creatures desire for help and acceptance remind you of anyone in your own life who has struggled to fit in or find help from others who do not understand that person? Do you believe the creatures actions toward Victor and his loved ones are justified? You might not approve of the killings, but do they make sense, and should he be blamed for them?Its about frankenstien*