What’s the definition of allies?

Answers

Answer 1

Answer:

a state formally cooperating with another for a military or other purpose.Explanation:

Answer 2

Answer:

the defintion of allies is like someone who sides along with you like in military stuff like for ex. WWII Germany's allies was Japan and other countries. They were on germany's side.

Explanation:


Related Questions

who is Queen Saba of ethiopian​

Answers

Queen of Sheba, Arabic Bilqīs, Ethiopian Makeda, (flourished 10th century bce), according to Jewish and Islamic traditions, ruler of the kingdom of Sabaʾ (or Sheba) in southwestern Arabia

I think your question is wrong

Read the passage from the myth of Romulus and Remus.

The founding of Rome revolves around two orphan boys named Romulus and Remus. Legend says that the boys were raised by a mighty wolf. The boys’ mother was murdered by an evil king named Amulius. The king then threw the two babies into the Tiber River. They washed up onto the banks of the river, where the wolf found them. Seeing the crying babies, she took pity on them. She gently picked them up in her teeth. She took the babies to her cave and fed them. She cared for them for years. The boys grew bigger and stronger. Eventually, a herder found the boys and took them home. He and his wife raised the boys. The boys decided to build a city where the wolf had fed them. However, Romulus and Remus fought over whom the gods favored. In this fight, Romulus killed Remus. Then Romulus founded Rome.

What role does the wolf play in the founding of Rome?

She builds the city.
She kills the founder.
She constructs the wall around the city.
She rescues the boy who becomes the founder.

Answers

The and answer is d she rescues the boy who becomes the founder

Answer:

The answer is D

Explanation:

She rescues the boy who becomes the founder.

Why is Spain a good example of how most conquered peoples of other faiths vere treated
under the Umayyad caliphate?

Answers

Answer:Jews and Christians there coexisted peacefully with Muslims, and were allowed to practice their own religions.

Explanation:

Analyze the political cartoon and explain what is going on in the image.

Answers

Answer:

results

Explanation:

they are waiting for there results

They are basically saying how it wasn’t fair and the rich people would change results and cheat because the poor had no power to do anything about it anyway

Hope this helps—xoxo

The main role of women in Sparta was to?

A-learn how to read and write.
B-prepare for government service.
C-raise warriors and instill Spartan values.
D-run their estates if husbands went to war.

Answers

D I believe good luck!

Explain what could be done to reduce the number of deaths by infectious diseases worldwide.
PLEASE HELP!!!!!! I WILL MARK BRAINLIEST AND YOU GET 20 POINTS!!!!

Answers

Not wearing a mask and breathing on everyone you see

Which type of living expense describes the money paid for necessary
services such as water, heat, and electricity in a home?
A. Utilities
B. Taxes
C. Insurance
D. Mortgage

Answers

Answer: A; Utilities

Explanation: Just did it on A pex

Utilities refers to the cash spent on things like water, heating, and power in a residence.

Option A. is correct.

Define expenses.

The cost of business that a firm incurs in order to earn revenue is referred to as an expense.

Utilities refers to the cash spent on things like water, heating, and power in a residence.

Option A. is correct.

Find out more information about expenses here:

https://brainly.com/question/17136150?referrer=searchResults

What did shays rebellion prove about the government under the articles of confederation?

Answers

Answer:

Shay's Rebellion showed the weaknesses of the Articles of Confederation. When the central government couldn't put down the rebellion, the first stirrings of federalism began to gather strength. ... The government gave most powers to the states, and the central government consisted only of a legislature.

I hoped I helped - GOOD LUCK

Please mark me brainliest!!

Which group of skilled workers fought for better pay and working conditions
in Philadelphia?
O A. Knights of Labor
O B. Scientific Managers
O C. Strikers of 1877
O D. United Immigrants
SUBMIT

Answers

The Philadelphia Knights of Labour were an organisation of skilled workers who advocated for improved wages and working conditions. Therefore, choice A is the best one.

The Knights of Labor was a labor union that fought for better pay and working conditions for skilled workers in Philadelphia and other parts of the United States during the late 19th century.

The Knights of Labor aimed to unite workers from different trades and industries to advocate for their rights and interests. They sought to address issues such as long working hours, low wages, unsafe working conditions, and lack of job security.

Thus, the ideal selection is option A.

Learn more about Knights of Labor here:

https://brainly.com/question/13486034

#SPJ1

The steam-powered plow and gasoline-powered tractor affected agriculture by helping farmers plant and harvest more efficiently. allowing farmers to use horses to tend to their crops. making planting and harvesting more time-consuming. forcing farmers to hire more workers to tend to their fields.

Answers

Answer:

The answer is A, (helping farmers plant and harvest more efficiently.)

Explanation: Because the steam powered plow was a more efficient and faster technology that helped them.

Answer:

A.) helping farmers plant and harvest more efficiently.

Explanation:

Hope this helps!!!! :>

(history is very hard)

Explain 9/11.

Don't copy from Wikipedia!

Answers

Answer:

9/11 is when the twin tower collapsed. I lived in new york for a year, and my parents told me the history

Explanation:

Answer: 9/11 was the tragic day on the twin towers collapsed due to a terrorist attack that killed over 100,00 People

Explanation:

make a short letter saying goodbye to 2020​

Answers

Dear 2020,

I would have to say 2020 has been a rollercoaster for everyone and not only myself.

We've had some really really really bad times, but how 2020 played out gave "hard times" a different meaning.

Although 2020 wasn't the best, we fought on and as hard as we could even if it didn't seem like people weren't doing much while sitting at home or wearing masks or listening to the chaos on TV.

We were doing the most we could and helping others lives by staying home.

We are heros for that, and fighters and we continue to fight past these blocks of problems.

but now all things must come to an end and we're all hoping for a better year in 2021.

Goodbye 2020.

why was the policy set out by the truman doctrine as containment​

Answers

Containment was Truman's method of stopping the spread of communism. The USSR tried to take over other countries with communism and at that point Truman would interfere to stop it from spreading even further.

Who was the most successful Progressive Era President? Explain.
Theodore Roosevelt
William H. Taft
Woodrow Wilson

Answers

Answer:

theodor roosevelt because he was the one president who ended slavery and banished it from the united states

Explanation:

I think answer should be Woodrow Wilson I hope this helps let me know if it’s correct

Which object has the most kinetic
energy?
a) a feather dropped from 5 feet
b) a basketball sitting on the ground
a boy skating down a steep hill
d) a truck falling off a cliff

Answers

Answer:

it would be d

Explanation:

if you look at the ratio of speed of each thing the feather does not have enough weight to gather enough kinetic energy in a 5 ft drop a basketball on the ground gains no kinetic energy due to no actions are taken upon it a boy skating down a steep hill is close but it is a slow and gradual build up but compared to the truck falling off a cliff it holds more weight and due to that it gains more speed

What is a plateau?
A. dense evergreen forest with abundant rainfall
B. large raised area of mostly level land
C. strip of land with water on both sides that joins two larger bodies of land
D. large region of flat grasslands that stretches through Argentina and Uruguay

Answers

A plateau is B - a large, raised area of mostly level land. :^)

how is the role of government changing in the 1890s

Answers

Answer:

These reformers favored such policies as civil service reform, food safety laws, and increased political rights for women and U.S. workers. ... Throughout the 1890s, the U.S. Government became increasingly likely to rely on its military and economic power to pursue foreign policy goals

Explanation:

how is north china and south china's geography different

Answers

Answer:

Alot!

Explanation:

The two sides of the Line have significant differences in climatology, vegetation, terrain, soil, and agriculture. The south is warmer and wetter in climate than the north of China. This is mainly because of the summer monsoons which move from southeast to northwest. Most of their moisture is left behind before they can reach the boundary line. The North China plain is relatively arid. These climate differences support different types of agriculture, with wheat (such as millet and maize) hence mantou (steamed bread) and noodles are the dominant staple in the north; while rice is produced and consumed more in the south. Vegetables in the south are a lot more abundant, as well as seafood.

Which country is know for its natural resources of gold and diamonds?

Answers

Answer:

south africa

Explanation:

Which of the following is NOT true of television journalism? Television is even more effective than the radio as an agency for influencing public opinion. We should form our opinions by listening to network commentators to get a well-rounded perspective. You must pay millions of dollars to build up and project the proper television image for their candidates. Television media performs a public service in the field of political education. As you can assemble from different sources we should listen to more than one commentator and read background articles in books and magazines.

Answers

Answer:

television is even more effective then the radio as an agency for public opinion

Explanation:

I WILL GIVE BRAINLIEST!!! HELP

Answers

Answer:

1,2,3,4, & 5,

Explanation:

Who was the women who won her freedom by saying that all men are
created equal?*

O Sojourner Truth

O Betty Davis

O Mum Bett

O Crispus Attucks

Answers

Answer:

benjamin franklin and wanna see my pokemon cards

Explanation:

dangelo russell or lonzo ball.​

Answers

Answer:

lonzo 100%

Explanation:

Answer:

Lonzo

Explanation:

D Lo is alright but Lonzo is better and Lonzo is going to get a ring before JA, Melo, and even Edwards.

Which showed that the economy was weaker than the stock market indicated during the 1920s? For edguinity

Answers

Answer:

I do that site too let me help

Explanation:

Bankruptcy of farmers showed that the economy was weaker than the stock market indicated during that time

What were the causes and effects of allied intervention in the Russian civil war?

Answers

Answer: It was lead by the Bolshevik party was essentially a revolution against the Pre-WWI Tsarist Regime. Lenin's Bolshevik's spread the idea of communism and equality among all it's citizens which incited the lower class against the upper class and Monarchy.

The results of the Russian Civil war was the establishment of the USSR. Finland, Estonia, Poland, Lithuania, and Latvia were established as sovereign states of the Soviet Union, with the Communist Party in power.

Explanation:

Choose the word or phrase that best answers each question. What quality makes The Pillow Book a credible source for examining life within the imperial court during the Heian period? How might The Pillow Book contain bias?

Answers

Answer:

a and b

Explanation:

The author directly observed the people on court

It might contain the authors personal feelings about events and people

Read this excerpt from The Riddle of the Rosetta Stone by James Cross Giblin.

In the next few years following the publication of his book, Champollion deciphered many more hieroglyphs. He was named "Keeper of the Egyptian Collections" in Paris in recognition of his accomplishments. Then, in 1829, he got what he had always wanted. With the backing of the French government, he journeyed to Egypt to see the ancient hieroglyphic inscriptions for himself.

Based on the details in the excerpt, readers can infer that Champollion had a strong desire to

visit Egypt.
publish books.
serve in government.
start a collection.

Answers

Answer:

its a took the quiz

viset egept

Explanation:

Answer:

A,   because when you ed the little paragraph it tells you.

What was needed for a British Colony to be created?

Answers

the answer is { CENSORED }

Look at the map and answer the following question.
Which of the following BEST describes the information shown by the lines on the map?
a. the National Road and the Lancaster Turnpike
b. the Hudson River and the Erie Canal
csettlers' routes to the West in the early 1800s
d. plans for Henry Clay's American System

Answers

B I’ve just got it right

The map above best reflects which turning point in history?
The map above best reflects which turning point in history

Answers

Political maps can reflect changes in the history of humanity because the territorial division of countries and communities is usually linked to an important historical fact.

What is a historical fact?

A historical fact is a term that refers to the occurrence of an event or situation of great magnitude that radically changes the human dynamics of the Earth and influences the territorial division.

An example of a historical fact are the world wars that changed the territorial distribution of most European countries in a short period of time.

According to the above, a map can reflect important historical facts when it expresses territorial modifications, massive human displacements, decrease or increase of the population in a place, among other factors.

Note: This question is incomplete because the map is missing. However I can answer it based on my general prior knowledge.

Learn more about maps in: https://brainly.com/question/1670085

Other Questions
who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution. WILL MARK BRAINLIEST:> IF YOU ARE LUCKY pick a number from 1 to 20 CLOSEEST NUMBER TO THE NUMBER I PICK WILL BE THE BRAINLIEST GOOD LUCK How do you make someone brainliest In the 1800s, unmarried women hadmore rights than married women.the same rights as married women.fewer rights than married women.no rights, just like married women. List and explain the major features that the following building designs must have to relate directly to their functions.-Hospital-Airport-Courthouse A student observes a difference in the activity level of fish at a pet store. The fish in an aquarium near the window are swimming around more quickly tha the fish in an aquarium placed in the back of the store. The student forms a hypothesis about the effect of sunlight on fish activity levels and arranges to conduct an experiment. Which variable could be an independent variable in the student's experiment? types of fish sold speed of swimming fish amount of time fish were active temperature of water in fish tank how do you do this equation ?solving inequalities 8 2x < x + 7 Need help with this math problem Bacteria reproduce in a process called binary fission which of the following is true about binary fission?