When the genotype consists of a dominant and a recessive allele, the phenotype will be like _________ alllele.

Answers

Answer 1

Answer:

dominant

Explanation:

It dominant because when a dominant allele is present it will always take that phenotype for example if being tall is dominant and short is recessive and the person has the genotype of Tt that person will be tall because that big T is there.

Answer 2
Dominant.

Recessive phenotypes can only occur when there are no dominant alleles and solely the recessive one.

Related Questions

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.


Which features form along all types of plate boundaries?
Hurry up!!

Answers

Explanation:

Ocean ridges features form along all types of plate boundaries.

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

The similarity of the structures shown in the picture suggests that the organisms_______

1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly

Answers

1 because they all had traits that had come form somthing

How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?

Answers

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.

Explanation:

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet

Explanation:

Pls help this is due today

Answers

Answer:

scientific method can help resolve problems logically

Answer:

b. scientific

Explanation:

the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.

hope this helps! lemme know if you need more

I have no clue and the internet doenst help

Answers

Answer:

Soda

Explanation:

These are some weird questions...

I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.

A 9.0 is how many times more powerful than a
4.0 on the Richter scale?

Answers

Answer:

It increases 31.7 times between whole number

values.

Explanation:

"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."

Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.


excluded from work

allowed to continue her duties as long as she does not start to feel worse

reported to the health department

restricted from working with food

Answers

Excluded from work because there’s risk of getting someone else sick and I think cross contamination

In your own words, can you explain where a hot
spot can be found AND what does it looks like?

Answers

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane

Answers

Answer:

moving across both the plasma membrane and the outer membrane

Explanation:

Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.

what are the four primary uses or benefits of the nguni breed amongst South African communities?​

Answers

Answer:

Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.

Explanation:

2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration

Answers

Answer:

A . the formation of male and female sex cell is known as gametogenesis

the answer is a (gametogenesis)

Nancy visits a local reservoir where she feeds ducks and other birds. Every time she feeds them she notices that they fight for the best pieces and some do not get any. All living things struggle to get the necessary amount of food, water, and shelter. What is the term for this struggle?

A. overproduction
B. natural selection
C. variation
D. competition

Answers

i think its competition

Can someone pls answer these multiple-choice questions, will mark as brainliest.

Answers

Awnser b is correct

What is anatomy?

Simple answer please!
I'll give brainlist

Answers

Answer:

Anatomy is the study of the bodies of people and other animals

hope this helps

have a good day :)

Explanation:

Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of

Answers

This supports the theory or mendal law of evolution bc the chromosomes Are aligned together

which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes

Answers

C asexual reproduction

Which of the following is a subsystem of an organism?

Answers

You didn’t post all of it

what is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide

Answers

Nucleotide is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide.

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

What is the main function of the central nervous system ? E2020

Answers

Answer:

The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation:

Answer:

Main function-the interpreter of the environment and  control over body movement.

The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..

Which statement is true about gene expression? Give brainlist is answer right

Cells become specialized because different cells contain different sets of genes

Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used

A cell becomes specialized by controlling the which proteins are produced from the cell's DNA

Answers

Answer:

I guess All of them

Explanation:

Gene expression has all of these statements as given above in text.

If a plant develops a toxin, how
might a herbivore evolve in
response?
A. The herbivore will most likely change its diet.
B. The herbivore will eat the plant until it
becomes immune.
C. The herbivore will gradually evolve a
resistance.

Answers

Answer:

a

Explanation:

It will probably change it's diet

Answer: A the herivabore will change its diet unless the plant in question is a fundamental key to its survival that C the herbivore will gradually evolve a resistance but the answer would be A as this is not explained in the question.

Compare photosynthesis and cellular respiration. In what types of cells do these processes occur?

Answers

Answer:

Cellular respiration occurs in both plants and animals.

But photosynthesis occurs only in plants. But photosynthesis can happen to 4 animals. It is only an exception, however. Sea slug and pea aphid may perform photosynthesis, oriental hornet, spotted salamander.

Explanation:

ATP is the main energy source of the cell. The most important final product of cellular respiration.

       The two main final photosynthesis products are glucose and oxygen.

Some of the cellular respiration enzyme reactions occur in the cytoplasm but the bulk is in the mitochondria. Inside the chloroplast, photosynthesis occurs.NADH is the high-energy cellular respiration electron carrier, while NADPH is photosynthesized as a powerful electron carrier.

In the cell chloroplasts, photosynthesis is carried out. This process gives energy directly or indirectly to all living organisms. Life on Earth would be no longer there without it.

Although photosynthesis needs energy and produces food, cellular breathing breaks food down and releases energy. Photosynthesis and respiration are carried out by plants while animals can only breathe.

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.

helpp mee pleaseeee need help

Answers

Answer: it will increase the frequency of the action potential hope this helps

Explanation:

Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?

Answers

Answer:

Do a literature search to find natural history information on closely related species.

Explanation:

In the context,  few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.

They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.

Other Questions
Which is a democratic belief or ideal that brings all Americans together?1.Americans all speak the same language.2. Americans come from similar backgrounds 3.Americans enjoy political and religious freedom 4.Americans are all the same color Find the missing side of the triangle. Round your answers to the nearest tenth if necessary.15.3 m10 m24.6 m22.4 m When adding tworational numbers whatwill the sign be if bothnumbers are positive? what Will You nota miss about remote learning Maya read 40 pages in 60 minutes Socioeconomic status (SES) refers to Group of answer choices the behavior patterns, beliefs, and all other products of a particular group of people that are passed on from generation to generation. a person's position within society based on occupational, educational, and economic characteristics. the degree to which development is similar or universal across cultures. a social label placed on a similar group of people based on their heritage, nationality, race, religion, and language. missing cardinal direction:En el sur de la ciudad hay un parque muy bonito. En el _ de la ciudad hayun lago muy grande y bonito. En el este hay un monumento muy interesantey en el oeste hay unas tiendas bonitas.A. norteB. estaC. centroD. sendaSUBMIT Why is anthropology a good tool for understanding migration? Angel went to the store to buy some chicken. The price per pound of the chicken is $4 per pound and he has a coupon for $2.75 off the final amount. With the coupon, how much would Angel have to pay to buy 2 pounds of chicken? Also, write an expression for the cost to buy p pounds of chicken, assuming at least one pound is purchased. Do economists have any particular expertise at making normative arguments? In other words, they have expertise at making positive statements (i.e. what will happen) about some economic policy, for example, but do they have special expertise to judge whether or not the policy should be undertaken? What did Byron ask the bully? Compound X has the formula C8H14.X reacts with one molar equivalent of hydrogen in the presence of a palladium catalyst to form a mixture of cis- and trans-1,2-dimethylcyclohexane. Treatment of X with ozone follwed by zinc in aqueous acid gives a ketone plus formaldehyde (CH2=O). What is the structure of X? Whats the answer to this ?? Someone please help with this ASAP!!! I will give brainliest Solve y = x + 6 for x.Ox = y + 6Ox= -y + 6O x = y - 6Ox= -y-6 The Law Enforcement Officers Safety Act of 2004, which allows off-duty officers and retired officers to carry concealed weapons throughout the country: Group of answer choices was ruled unconstitutional in U.S. v. Miller. was strongly supported by the International Association of Chiefs of Police. was strongly opposed by the International Association of Chiefs of Police. provides for nationwide standards of use-of-force and firearms training. What is the. Length of a i need help plzi will mark you brainlest You plan to use a slingshot to launch a ball that has a mass of 0.019 kg. You want the ball to accelerate straight toward your target at 23 m/s2. How much force do you need to apply to the ball? identify which of the 3 freedoms guaranteed by the bill of rights are the most important to you. Explain your reasoning in 1-2 paragraphs.freedom of speech, press, or religion?