Answer:
inflammatory cytokines
Explanation:
In host cellular defense systems, non-specific immune responses are integral. It is a general white blood cell-mediated reaction where cells respond quickly to pathogenic infiltration.
Here, receptors on cells detect or even respond to signals from damaged, injured or stressed cells- these signals, such as inflammatory cytokines in a cytokine storm of molecules, in response to signatures shared by a wide range of pathogens.
Compare the nervous system of the shrimp to that of a vertebrate.
Answer: The majority of animals on our planet, about 95 percent, do not possess a true backbone and are called invertebrates. It's common knowledge that vertebrates like humans have a complex nervous system that reacts to stimuli, but much less is known about invertebrates like shrimp and insects. While it's somewhat different from that of vertebrates, shrimp do have a central nervous system comprised of four main parts.
Explanation:
The nervous system is a highly specialized organ found in vertebrates.
The nervous system
The nervous system is a complicated system in the body of a vertebrate that is made up of the peripheral nervous system, which includes cranial nerves, spinal nerves, involuntary nerves, etc., and the central nervous system, which includes the brain and spinal cord.Neurons in the nervous system primarily relay signals to the various bodily parts.Somatic and visceral components are part of the peripheral nervous system.The two halves of the vertebrate nervous system are the grey matter and the white matter.The central nervous system and the peripheral nervous system make up the nervous system.The spinal cord and the brain, which regulate all bodily functions, make up the central nervous system.The cranial and spinal nerves, on the other hand, are part of the peripheral nervous system, which links the central nervous system to the rest of the body.Nerves carry electrical impulses from the skin and other sensory organs to the brain, which interprets the stimuli and delivers a reaction to the muscles and glands of the body.learn more about it
https://brainly.com/question/15202873
#SPJ2
You are observing the sun through a solar telescope. You see darks spots on the surface. Which solar property are you observing?
A Convection
B Sunspots
C Prominences
D Solar flares
Answer:
B
Explanation:
The spots are an area of cooler surface temperature caused by magnetic field flux.
Which of the following is NOT a function of the skeletal system?
A, Providing a framework for muscles
B. Creating new blood cells
C. Fighting disease
Answer:
From help from another user my answer was wrong to begin with the answer is C.
Explanation:
Most blood cells are created in bone marrow, the spongy substance found inside the bone structure.
B is a function of the skeletal system
The bones make the frame work of the body which allows us to stand and keep structure instead of being like slime.
A is a function of the skeletal system
ONCE AGAIN: The correct answer is C
HURRY PLZ
2. Define Homologous Chromosomes
A. Chromosomes that make up each pair of chromosomes in a body cell, for each of
the 23 pairs in humans, one comes from mom, the other from dad,
B. Copies of the original chromosomes
C. Allele that hides the recessive allele,
D. Pure
Why is meiosis important for organisms?
It allows for genetic variation among organisms.
It determines which genes are dominant and which are recessive.
It produces genetically identical cells.
It provides a means of asexual reproduction.
IM TIMED
Answer:
A - It allows for genetic variation among organisms.
Explanation:
Its basically sex or sexual reproduction. Which later allows for genes to spread and vary. Which create families in animals and humans.
Because Meiosis is Sexual Reproduction
Hope this Helps!
:D
A student is comparing the cells of a prokaryote, an animal, and a plant.
Identifying which two cell parts would show that the cell was a plant cell, and not
a cell of a prokaryote or an animal?
a. nucleus and mitochondria
b. cell wall and chloroplast
c. cell wall and cell membrane
d. cell membrane and mitochondria
Answer: b. cell wall and chloroplast
Explanation:
What happens over time to rock that is stressed?
A The rock becomes gravel
D. The color of the rock changes.
C. The rock melta to liquid
D. The shape of the rock deforms
SUMMIT
Answer:
The rock becomes gravel
Explanation:
Answer:
The shape of the rock deforms
Explanation: i took a quiz on a.pex and it was right
Cellular respiration refers to _____.
A releasing cellular energy through secretion
B the synthesis of cellular materials
C breathing
D the breakdown of sugar molecules in food to release energy
Answer:
D
Explanation:
Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.
Answer:
D. The breakdown of sugar molecules in food to release energy.
Explanation:
Cellular respiration is converting the glucose in your food to ATP in the mitochondria of the cell to produce energy for living.
Energy is converted from glucose, in the presence of oxygen, into numerous ATP molecules during
Answer:
Cellular respiration
Explanation:
PLEASE HELP AND THANK YOU!!!
Think about the factors that will influence the evolution of humans in the future. Name one factor that would exert influence through the process of natural selection and one factor that would exert influence through artificial selection.
A. natural selection: genetic engineering; artificial selection: demands placed on the brain
B. natural selection: individual mating choice; artificial selection: diseases
C. natural selection: diseases; artificial selection: genetic engineering
D. natural selection: demands placed on the brain; artificial selection: diseases
Part C
Projected values are only estimates. Can you think of either a natural or artificial factor that could increase or decrease the actual amount of wind energy the United States produces in the future?
Edmentum sample explanation:
Technological advancements in the future could lead to the production of higher-efficiency turbines, which could generate more electricity than originally predicted. Climate changes over time could affect wind speeds in a region, leading to higher or lower energy production.
The factors that would exert influence through the process of natural selection are a natural selection: diseases; artificial selection: and genetic engineering. The correct option is C.
What is natural selection?The strongest survive through natural selection, and the most favored traits endure through evolution. Natural selection is the result of selection pressure on a population's frequencies of a specific allele. Evolution is the process through which, over an extended period of time, new sets of naturally selected organisms emerged.
Future technological developments might result in the creation of turbines with a higher efficiency, which might produce more electricity than was initially anticipated. Wind speeds in a place may alter as the climate shifts through time, which could result in increased or decreased energy output.
Therefore, the correct option is C. natural selection: diseases; artificial selection: genetic engineering.
To learn more about natural selection, refer to the link:
https://brainly.com/question/14118238
#SPJ6
A student produces a labeled drawing of a virus for a presentation. The student states that the capsid has a function similar to the nuclear membrane found in animal cells.
Which of these describes the similar functions of capsids and nuclear membranes?
Both code for the proteins needed for reproduction of the structures.
Both code for the proteins needed for reproduction of the structures.
Both provide energy for activities in the structures.
Both provide energy for activities in the structures.
This question is incomplete, here is the complete question:
A student produces a labeled drawing of a virus for a presentation. The student states that the capsid has a function similar to the nuclear membrane found in animal cells. Which of these describe the similar functions of capsids and nuclear membranes?
A. Both transport proteins throughout the structures
B. Both provide energy for activities in the structures
C. Both protect genetic information for the structures
D. Both code for the proteins needed for reproduction of the structures
The correct answer is C. Both protect genetic information for the structure.
Explanation
The capsid is the structure that protects and contains the genetic information of a virus, it is composed of proteins. On the other hand, the nuclear membrane of an animal cell is a structure that allows the cell to protect the DNA information, and to separate the chromosomes from the rest of the cell. According to the above, the capsid and the nuclear membrane of an animal cell have a similar function to protect the genetic information. So, the correct answer is C. Both protect genetic information for the structure.
Viruses are known to have different many shapes and sizes. The option that best describe the similar functions of capsids and nuclear membranes is that both protect genetic information for the structures.
The shapes of viruses are divided into four groups. They are;
FilamentousIsometric (or icosahedral) enveloped, head tail.The size and shape of a various can be determined by the amount and arrangement of the proteins and nucleic acid of the viruses. Note that the nucleic acid and proteins of each class of viruses often comes togetheer by themselves and form a structure called a nucleoprotein.
Learn more about Virus from
https://brainly.com/question/17173059
1. Explain the change in erythrocyte count in the case of anemia
2. Where are red blood cells produced?
3. What type of cells help blood to clot?
4. What makes the human circulatory system efficiently carry oxygen to the tissues?
5. Describe the role of blood plasma.
6. Explain the role of lymph in our body
Define concentration gradient.
Answer:
A concentration gradient occurs when the concentration of particles is higher in one area than another. In passive transport, particles will diffuse down a concentration gradient, from areas of higher concentration to areas of lower concentration, until they are evenly spaced.
Will mark brainliest!
Please answer both questions will give extra points!!!
Please answer them in complete sentences same with the picture above :)
Question 1) Where did you get your chromosomes from? How many do you have ?
Answer: 1. Chromosomes come in matching pairs, one from each parent.
You have a total of 46 chromosomes 23 from mom and 23 from dad.
2. Yes, because chromosomes come from parents so in this case yes.
Explanation:
Fragmentation occurs when a large area of ecosystem is divided into smaller, isolated areas due to deforestation. After fragmentation, changes to the ecosystem can occur. Which is most likely an effect of fragmentation on an ecosystem?
a. Animal species in the fragmented area utilize new food sources in the deforested area.
b. Plant species from the deforested area alter conditions at the edge of the fragmented area.
c. The nutrient cycle is replenished by new species colonizing the deforested area.
d. Most native species disappear from both deforested and fragmented areas.
Answer:B
Explanation:
what is meant by locomotor skill
Answer:
Body moving from one place to another in a vertical plane. Develop bodily control. Walking, running, leaping, jumping, hopping, galloping, sliding, & skipping.
Explanation:
Which of the following is an example of incomplete dominance
Please help me idk if it’s right
Answer:
Yeah I think you are good.
Explanation:
You followed basic gene rules, it should work
Cookware companies have been using a chemical called C-8, which helps to create a nonstick coating to pans. However, the Environmental Protection Agency (EPA) recently claimed that the use of C-8 in the manufacturing of nonstick cookware should be discontinued because studies show it causes cancer.
Who might benefit financially the most from the EPA’s claim?
Answer:
Explanation:
The choices provided are:
a.restaurants that use C-8-coated cookware
b.cookware manufacturers who make pans out of steel only
c.stores that sell C-8 nonstick cookware
d.individuals who use steel cookware at home
From these choices B is the correct answer.
Restaurants that use C-8 cookware will not profit from using it but will need to lose money by replacing the old C-8 coated cookware.
Stores that sell this nonstick cookware will also need to replace their inventory so they won't be making extra money, only losing it.
And individuals at home will still be using steel cookware and won't benefit or lose anything by this change with the regulations of the c-8 coated nonstick cookware.
Measuring Populations (brainliest)
Answer:
I believe your answer would be C: interactions between individuals
Explanation:
Brainliest if this is correct?
Answer:
Letter C, interactions between individuals
Explanation:
Also, I love your profile pic!!
Which organisms are prokaryotes?
A. archaea
B. fungi
C. protists
D. plants
A AAAAAAAAAAAAAAAAAAAA
ARCHAEA
what are bony platelet?
Answer:
a minute colorless anucleate disklike body of mammalian blood that is derived from fragments of megakaryocyte cytoplasm, that is released from the bone marrow into the blood, and that assists in blood clotting by adhering to other platelets and to damaged epithelium — called also blood platelet, thrombocyte.
Similarly, you may ask, what is the medical term for platelets?
The medical term for having too many platelets is thrombocytosis, and there are two types: Primary or essential thrombocytosis – Abnormal cells in the bone marrow cause an increase in platelets, but the reason is unknown.
What is the medical name for platelets?
Platelet: An irregular, disc-shaped element in the blood that assists in blood clotting. During normal blood clotting, the platelets clump together (aggregate). Although platelets are often classed as blood cells, they are actually fragments of large bone marrow cells called megakaryocytes
Explanation:
Platelets are fragments of megakaryocytes, which are very large cells in the bone marrow. They aid in the formation of blood clots, which slow or stop bleeding and aid in the healing of wounds.
What is blood clotting?When a blood vessel is injured, blood clotting, or coagulation, is an important process that prevents excessive bleeding.
Platelets (a type of blood cell) and proteins in plasma (the liquid component of blood) collaborate to stop the bleeding by forming a clot over the injury.
Red bone marrow is responsible for the production of blood cells (hematopoiesis). Stem cells in your red bone marrow (hematopoietic stem cells) produce red, white, and platelets, which are all components of your whole blood.
Platelets are fragments of megakaryocytes, which are very large bone marrow cells. They promote the formation of blood clots, which slow or stop bleeding and aid in wound healing.
Thus, these are the main functions of platelets.
For more details regarding blood clotting, visit:
https://brainly.com/question/11230651
#SPJ2
Help me with this
A . Name the separation technique that can be used to separate lighter particles and heavier particles. Explain the principle behind this separation method
Answer:
Purification techniques
Answer:
It is just the techniques purification
Explanation:
in which direction will air currents most likely move
A. from the land to the sea
B. straight up above the sea
C. from the sea to the land
D. straight down over the land
Which of the following is NOT a threat to living ocean organisms?
A. evaporation
B. oil spills
C. pollution
D. over fishing
Global climate has changed in the past due to 1. __ and 2. __
1- air pollution
Earthquakes
Or plate tectonics
2- milankovitch cycles
Lunar phases
Or global warming
Answer: I think its air pollution and Global warming
Explanation:
Answer:
The answer is actually 1. plate tectonics and 2. Milankovitch cycles.
Explanation:
I got this correct on odyssey
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
Exercise 1:
DNA ATACGAAATCGCGATCGCGGCGATTCGG mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|SerExercise 2:
DNA TTTACGGCCATCAGGCAATACTGG mRNA AAAUGCCGGUAGUCCGUUAUGACC CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|ThrSmalles to greatest
Answer: cells, tissues, organs, organ systems, organism
Explanation:
A. Amber and evolution
B. Cast and imprint
C. Theory, cast
D. Carbon dating and radioactive isotopes
Answer:
A. Amber and evolution
Which macromolecule and function are correctly matched? *
A. Lipids are used to build things like your hair, skin, nails, and muscles and are also
enzymes
B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.
C. Proteins and Lipids give us energy.
D. Carbohydrates contain your genetic information.
Answer: B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.
Explanation: