Answer:
meiosis
Explanation:
meiosis is used to produce gametes for sexual reproduction
Answer:
Meiosis, and female and male
Explanation:
Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.
Which belongs in each place
Answer:
1=e, 2=b, 3=c, 4=d, 5=a
Explanation:
.
Identify the advantages and disadvantages of internal and external fertilization
If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.
Answer: C.
has different alleles on the chromosomes in a chromosome pair
Explanation:
Hetero means different.
A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.
What is the particular trait for heterozygous organism?When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.
Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.
The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.
Therefore, has different alleles on the chromosomes in a chromosome pair.
Learn more about heterozygous here:
https://brainly.com/question/29327683
#SPJ2
10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.
Answer:
I would Say the answer is D
Explanation:
Answer:
I I think it’s D
Explanation:
D the planets are much smaller than the stars they orbit.
True or False: Epinephrine enters
the cell after it binds to the receptor.
Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.
What are the functions of epinephrine?
Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.
Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.
Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.
Learn more about epinephrine:
https://brainly.com/question/3882731
#SPJ2
Anaerobes carry on whereas aerobes carry on cellular respiration
Answer:
Anaerobes carry on cellular respiration in the absence of oxygen, whereas aerobes carry on cellular respiration in the presence of oxygen.
Explanation:
Many of the cell processes needed need some energy to occur. Cellular respiration is the process by which cells degrade organic compounds and turn them into energy. Cellular respiration follows two ways, which depend on the presence or absence of oxygen, and both of them begin with the process of glycolysis, which occurs in the cytoplasm and does not need oxygen to occur.
Aerobic Respiration
Occurs in the presence of free oxygen.Series of reactions by which pyruvic acid (product of glycolysis) turns into CO₂ and H₂O, producing many ATP molecules. Respiration occurs in the mitochondria.Takes place in two steps or stages: Krebs cycle and electron transporter chain. Glycolysis and Krebs cycle produce electrons, which then travel along the electron transporter chain while releasing energy, and ATP is produced.Anaerobic Respiration
Occurs in the absence of free oxygenSeries of reactions by which using pyruvate (product of glycolysis) 2 ATP molecules van be produced. There are two ways in which anaerobic respiration can be produced: lactic fermentation and alcoholic fermentation. Lactic fermentation produces lactic acid and 2 ATPAlcoholic fermentation occurs in two steps, and the final products are ethylic alcohol, 2ATP, and 2 CO₂The whole anaerobic process occurs outside the mitochondria.I’m not sure if anyone knows this or not, can someone try and help me with this question!
Answer:
it gives them a mental picture of where they need to plant and pick the cotton
Explanation:
Hope this helps
In the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water
Answer:
50% water and 50% vinegar
Explanation:
You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes
How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?
Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
What are some environmental indicators?
DNA stands for eoxyrevolution acid deoxyribonucleic acid.
Answer: yea im or re.tarded
Explanation:
Answer:
Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around. RNA strands are created using DNA strands as a template in a process called transcription,
Explanation:
how does water pollution harm water ecosystems?
Answer:
the animals die due to the chemicals and stuff in the water
Explanation:
Every cell contains DNA. The main purpose of DNA is to store the cell’s genetic information. How does DNA control the cell?
A. DNA activates nerve signals in the nervous system
B. DNA speeds up chemical reactions and lowers activation energy
C. DNA protects the cell from invaders.
D. DNA determines what proteins are made.
Answer:
The answer is D: DNA determines what proteins are made.
Explanation:
The nucleotide sequences that make up DNA are a “code” for the cell to make hundreds of different types of proteins; it is these proteins that function to control and regulate cell growth, division, communication with other cells and most other cellular functions.This process is called protein synthesis.All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. It is often compared to a blueprint, since it contains the instructions to construct other components of the cell, such as proteins and RNA molecules.
Hope this helps!! ;)
DNA controls the cell by determining what protein are synthesized by the cell. Thus, the correct option is D.
What is Translation?Translation is the process of synthesis of proteins from the mRNA (messenger RNA) of the cell. This process occurs in the ribosome of the cell. In this process, the mRNA produced from the DNA encodes amino acids which join together to form large polypeptide and protein molecules.
mRNA are produced from DNA through the process of transcription. Transcription occurs in the nucleus of the cell. Through this process, DNA produces a sequence of mRNA which is complementary to it. This mRNA determines what proteins will be synthesized by the cell.
Therefore, the correct option is D.
Learn more about DNA here:
https://brainly.com/question/264225
#SPJ6
What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.
Answer:
B.
Explanation:
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal
Answer:
dragon warrior or whatever it is called I don't maybe I am right
A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):
Answer:
it could probably be host
Answer:
A plant or animal that carries disease or parasite during part of its life cycle is called a host
I HOPE IT HELPS ❤❤True or false the main source of energy and water cycle is gravity
Answer:
False please mark me brainlest.
Explanation:
1. What Does DNA stand for?
Answer:
deoxyribonucleic acid
Mitosis is responsible for growth, repair, and maintenance in an organism because
a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.
Answer:
The correct answer is c
Explanation:
USA test prep
List body external and internal defenses
Answer:
External would be skin, nose hair, etc. Internal is white blood cells and bacteria that the body makes to help prevent infections.
Explanation:
During which phase of mitosis do the chromosomes pull away from the middle of the cell?
In Anaphase of mitosis chromosomes pull away from the middle of the cell.
During this period the replicated chromosomes are split and moved to the opposite poles of the cells.What is mitosis?It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.
What are chromosomes?It is along DNA molecule with part or all of the genetic material of an organisms.
To know more about mitosis here
https://brainly.com/question/26678449
#SPJ2
In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!
Answer:bottom
Explanation:
In this lab, you will simulate birds with three
different beaks. After watching the birds feed, you
will remove fruit to simulate a change in the
environment. What question are you answering by
doing this observation? Write it by filling in the
blanks below.
What is the effect of
on..
Answer:
1.
The independent variable is the type of food available.
2.
The dependent variable is the frequency of each type of beak (or number of birds with each beak type).
Explanation:
ong
plz help i need it i have to turn it in tomorrow
1.Gravity
2.spheres
3.bigger
4.planets
5.ground
6.interia
7.straight
8.force
9.direction
10.holds
11.balance
GOOD LUCK !
how do gray whales migrate?
Answer: Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.
Explanation:
Please help I'm behind
Answer:
B : Barometer
Explanation:
A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.
The energy related to the motion of an object is called ___.
Answer:
The answer is kinetic energy
Explanation:
Which is more concentrated in starch beaker or tube?
Answer:
beaker
Explanation:
it is more concentrated