Answer:
D. the only method of scientific investigation is in essence demonstrating the hypothesis is valid through repeated and more vigorous investigation using sound experimental techniques to produce the same or very similar results, ideally obtained from larger scale longitudinal studies, increasing sampling size and scale to lend greater and greater quality data on any query
List 5 things that cellular respiration and photosynthesis have in common.
Organelles wear out just like the parts to a machine. The cell is always repairing old organelles or completely breaking them down and replacing them with new ones. Imagine that a mitochondrion is old and worn out. What organelle(s) could be responsible for "disposing" of it?
The organelle that is responsible for removing worn out cells are the lysosomes.
What are lysosomes?Lysosomes are the organelles found within a cell that contains digestive enzymes called the lysozyme which are used to digest old and worn out mitochondria and wastes from the cell.
Therefore, the organelle that is responsible for removing old and worn out mitochondria are the lysosomes.
Learn more about lysosomes here:
https://brainly.com/question/5534167
#SPJ1
Select the correct location on the image.
Students are having a group discussion and notice that Maria has not had a chance to introduce her thoughts.
Which student response best draws Maria into the discussion?
Is Maria even
paying attention?
Maria, what do
you think?
Don't you
agree, Maria?
Alright, Maria, will
you settle this
argument?
Is Maria even paying attention? is the student response which best draws Maria into the discussion.
What is Discussion?
This is defined as the process of talking with people about a particular subject or topic.
Is Maria even paying attention? will make her alert and more involved so as to know what is being talked about.
Read more about Discussion here https://brainly.com/question/514815
#SPJ1
Answer:
Maria What do You think
Explanation:
The Least rude Way Of saying it
how can global warming lead to changes to the Earth's surface?
Answer:
It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.
choose the correct answer
number 2
number 2 because the colour doesnt matter
You are provided with three liquids - Water, honey and oil. On pouring the three liquids simultaneously without disturbing. What will be the arrangement of these liquids from top to bottom and why? Conduct this experiment at home and paste the picture of it with proper labeling
Answer:
Honey would be on the bottom, water in the middle, and oil on the top.
Explanation:
Honey is on the bottom because it has a is greater density than water, and oil is on the top because it has less density than water.
It all depends on the viscosity of the materials. Honey on the bottom, oil floating on top and in the middle is water.
What kind of liquids float on water ?The liquids which are in lesser weight just floats over the surface of water.
In the attached image it can be seen clearly that the denser of all is honey which has the property of viscosity as well and it just settles down on the surface whereas the lighter of all is the oil which is seen floating on the surface.
Oil and Water is usually the most common type of example of the two types of immiscible liquids. In this no matter what quantity you mix the oil and water in that they do not mix up . The reason why this happens is as of the basic chemical nature of the oil and the water molecules.
Learn more about miscible liquids at :
https://brainly.com/question/2193479
#SPJ2
What trait is recessive in the picture
Shortness is the recessive trait
What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional
Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent
the correct answer is detergent which is not approved
The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.
What is a hand sanitizer?Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.
Detergents are not approved during the formation of hand sanitizer.
Thus, the correct option for the given scenario is D.
For more details regarding sanitization, visit:
https://brainly.com/question/4296165
#SPJ2
Punnett squares are used by geneticists to determine the probability of different offspring genotypes. In the one shown below, what letter(s) belong in the lower right box?
Answer: aa
Explanation:
In a Punnett square, the lower right box will use the right letter on the top and the bottom letter along the left. This means we end up with: aa
See attached for more.
Read more about Punnett squares here:
https://brainly.com/question/3665972
which phrese does not describe oceans near the equator
Low lightning does not describe oceans near the equator. thus option D is correct..Low tempretare, low salinty and low density are the other options which are not mention in question.
Which oceans are near the equator?The Pacific, Atlantic, and Indian Oceans are all located along the equator.
Low lighting does not describe oceans near the water because they receive maximum sunlight in the daytime. As a result, the equator experiences significantly stronger sunshine than the north and south poles, which warms the water there.Low tempretare, low salinty and low density are phrase describe ocean near the equator.
Learn more about oceans near equator here:
https://brainly.com/question/25780353
#SPJ1
Which term best describes this step of the investigative process?
Experiment is the best term to describe the step of investigative process.
Experiment.This is a procedure carried out under controlled conditions in order to discover an unknown effect or law, to test or establish a hypothesis, or to illustrate a known law.
Read more on Experiment:
https://brainly.com/question/17274244
#SPJ1
• which of the following is required for the sodium-potassium ions into an animal cell?
Answer:
Energy from ATP
Explanation:
ATP, or adenosine triphosphate, is a chemical that transports energy within cells. It is the cell's primary source of energy, and it is produced via photophosphorylation (adding a phosphate group to a molecule using light energy), cellular respiration, and fermentation. ATP is used by all living organisms. It is employed in signal transduction pathways for cell communication and is integrated into deoxyribonucleic acid (DNA) during DNA synthesis, in addition to being an energy source.
. Which describes the function of the cell cycle in such single-celled organisms?
reproduction
repair
growth
protection
Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?
The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.
What is Taxonomic classification system?This is defined as the classification of organisms based on shared characteristics.
This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.
The complete question is:
Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.
Which of the following best explains why a standardized classification system is important to the scientific community?
Read more about Taxonomic classification system here https://brainly.com/question/11724129
#SPJ1
How might compound leaves and leaves with lobed margins be well-suited to windy environments?
Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.
What is a plant adaptation?A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.
Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.
In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.
Learn more about plant adaptations here:
https://brainly.com/question/29594
#SPJ1
Which of the following best explains how monkey is able to exchange gases with its environment and deliver oxygen throughout its body?
The ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.
What is respiratory system?The respiratory system is defined as one of the body systems that are made up of a network of tissues and organs that aid in the exchange of carbon dioxide and oxygen.
The oxygen passes from the environment into the nostrils. It is then conveyed by the trachea to the bronchi and arrives at the alveoli where the oxygen is delivered to the body cells.
Therefore, the ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.
Learn more about respiration here:
https://brainly.com/question/18169685
#SPJ1
What is meant by solar energy?
Answer: Solar energy is the radiation from the Sun capable of producing heat, causing chemical reactions, or generating electricity.
Explanation:
Answer:
Renewable energy produced by the sun. It is carbon neutral but unreliable.
Otters spend most of their time in the water. Over time otters have developed a coat with soft underfur to trap warm air near their skin and an outer layer of longer hair that keeps them dry underwater. Which of the following describes how otters developed this type of fur coat?
The otters adapted gradually over many generations.
The otters adapted gradually over many generations.
Cold weather triggers the underfur to grow each winter.
Cold weather triggers the underfur to grow each winter.
The otters mated with other aquatic mammal species having thick fur.
The otters mated with other aquatic mammal species having thick fur.
The significant amount of time otters spend grooming their fur encouraged this trait.
The significant amount of time otters spend grooming their fur encouraged this trait.
Answer:
Cold weather triggers the underfur to grow each winter.
Explanation:
this is because they would freeze in the cold water in the winter.
The backbone is also known as the vertebral column. Justify in accordance with both the
terms used
which of these describes the gulf stream
Answer:
The Gulf Stream is formed from the convergence of the North Atlantic Equatorial Current bringing tropical water from the east, and the Florida Current that brings warm water from the Gulf of Mexico . The Gulf Stream takes this warm water and transports it northwards along the U.S. east coast . As a western boundary current
What do you think are the biggest advantages & disadvantages regarding the kind of technology we have access to in the early 21st century?
Answer:
one among the biggest advantage of technology is increasing and improvement of living standard of peopleand the biggest disadvantage of technology is unemployment because machines replaced human laborThad rolls his bowling ball down the lane with a
force of 63 Newtons. If his ball has a mass of 7 kg,
what is the resulting acceleration of the ball?
35.
The acceleration of the ball is, 9m/s.
How, explain your answer briefly?Given data:
The mass of the bowling ball is, m = 7 kg.
The magnitude of force offered by ball is, F = 63 N.
The above problem is based on the Newton's second law of motion. According to the Newton's Second law of motion, the applied force is equal to the product of mass and acceleration of the body.
So,
F = ma
Solving as,
a = F/m
a = 63/7
Thus, we can conclude that the acceleration of the ball is, 9m/s.
Learn more about Newton's second law here:
brainly.com/question/13447525
#SPJ1
Sebastian wants to make ball-and-stick models of the four macromolecules. He has colored balls for each of the elements in these molecules, including the following.
red: hydrogen
black: carbon
purple: oxygen
green: nitrogen
Which molecule could he make that consists of long chains of red and black colored balls?
carbohydrates
lipids
nucleic acids
proteins
Macromolecules are defined as large molecules like lipids, proteins, and carbohydrates.
In the given data, the red colour denotes hydrogen and black denotes carbon. The molecule that needs the majority of red and black color is carbohydrates. Thus, option "A" is correct.
What are Carbohydrates?Carbohydrates can be explained as:
Carbohydrates are the macromolecules, generally referred to as sugar. Carbohydrates are the primary nutrients of the diet along with proteins and fats.
Carbohydrate is a biomolecule that is made up of carbon, hydrogen, and oxygen atoms. The monomeric units of carbohydrates are monosaccharides.
Thus, the correct answer is Option A.
To know more about carbohydrates, refer to the following link:
brainly.com/question/16987478
#SPJ1
match each example of a conflict with what it tells you about the character invloed
An example of a conflict is that Beverly is going to make Millicent's challenge extra tough: she seems to enjoy treating people badly.
What is a conflict?A conflict simply refers to any form of disagreement, misunderstanding, or struggle that arises between two (2) or more parties, especially due to any of the following reasons;
Differing opinionsIncompatibilityA difficult challenge.Opposing viewSuperioritySome examples of a conflict with what it tells about the character include the following:
Beverly is going to make Millicent's challenge extra tough: she seems to enjoy treating people badly.Tracy is rejected by the sorority because of the way she appears: she doesn't look and act like the people who are popular.Millicent is unwilling to abandon her old friend Tracy: she thinks being a good friend is more important than being popular.Millicent is starting to question being in a group: she takes time to think things though carefully.Read more on conflict here: brainly.com/question/24769299
#SPJ1
Identify the stages of the water cycle where water moves downward from the force of gravity.
Answer:
we have six stages of water cycle
another name for the cell, or plasma, membrane
Another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).
What is the plasma membrane?The plasma membrane is a physical barrier that separates the cell from its surrounding environment.
This barrier (plasma membrane) is fundamental to maintain the internal homeostasis state of the cell.
In conclusion, another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).
Learn more about the plasma membrane here:
https://brainly.com/question/734740
#SPJ1
Describe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease
Answer:
escribe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease
Explanation:
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA
In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
What are restriction enzymes?Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).
These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.
In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
Learn more about restriction enzymes here:
https://brainly.com/question/15278286
#SPJ1
You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.
A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.
What are salinity and conductivity measurements?Salinity is a measure of the salt content of a water body.
Conductivity is a measure of the electrical conductivity of a solution or substance.
Conductivity increases with increase in salinity.
An estuary is a region where salt water from the sea meet freshwater from a river or stream.
At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.
Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.
Learn more about salinity and conductivity at: https://brainly.com/question/2472580
#SPJ1