Which table represents a linear function?

Which Table Represents A Linear Function?

Answers

Answer 1
Answer would be C b/c it just is okay ! Get me point already
Answer 2

Answer:

c I am pretty sure of deep nuts u am playin it c


Related Questions

What is the perimeter of the rectangle above


A.16 cm

B.12 cm

C.20 cm

D.24 cm

Answers

Answer:

D. 24 cm

Step-by-step explanation:

perimeter = 8+8+4+4 = 24

help please hurryyyy!!! help pls hurry

Answers

Answer:

3 is 18

4 is 14

5 is 10

6 is 6

I hope this helps

PLEASE HELP ME ASAP PLEASE!!! THANK YOU

You can transform ⨀A to ⨀A' by translating it and then performing a dilation centered at A'. Find the translation rule and the scale factor of the dilation

Simplify the scale factor and write it as a proper fraction, improper fraction, or whole number.

Translation: (x,y)↦ (____, ____)

Scale Factor: ____?

Answers

Answer: x=-10, y=-5 or -2/1. And it's dilated by 2. & i believe the scale factor is 2.

Step-by-step explanation:

What i did was simply count from the radius (the tiny dot in the center) up, and   i counted 3, and did the same w/ the A' so I got 6, why makes me assume the scale factor is 2. then i did rise/run and i went  10 left and 5 down. So that makes -10,-5.

London is going to invest $8.8oo and leave it in an account for 10 years.
Assuming the interest is compounded continuously, what interest rate, to the
nearest hundredth of a percent, would be required in order for London to
end up with $13.400?

Answers

Answer:

k = 0.04205029854

k = 4.205029854%

Step-by-step explanation:

13400 = 8800(e)^10(k)

ln 1.52 = 10k ln e

(ln 1.52)/ 10 = k

Answer:

The interest rate would be 4.21%

The second of the three numbers is 4 times the first the third is 2 more than the second. If the second number is decreased by twice the third the result is 28 what are the three numbers

Answers

Answer:

the three numbers = -8, -32, -30

Step-by-step explanation:

let the first number = a

let the second number = b

let the third number = c

From the first statement:  b = 4a

From the second statement: c = b + 2

From the third statement: b - 2c = 28

From the above equations, we can solve (1) and (2) together.

c = b + 2

b = c - 2

Also, b - 2c = 28

(c - 2) - 2c = 28

c - 2 - 2c = 28

-c = 30

c = -30

b = -30 - 2

  = -32

b = 4a

a = b/4

a = -32/4

a = -8

Therefore, the three numbers = -8, -32, -30

Find the mean, median, mode, range.

Answers

Answer:

1. mean: 5

2. median: 6

3. mode: 80% or 8

4. range: 7

Step-by-step explanation:

Answer:

mean = 5

median = 6

mode = 80%(aka 8)

range = 7

Step-by-step explanation:

The manager of a home store is buying lawn
chairs to sell at his store. Each pack of chairs
contains 10 chairs. The manager will sell each
chair at a markup of 20% of the wholesale
cost, plus a $2.50 stocking fee.

Answers

Answer:

5$

Step-by-step explanation:

Line A and Line B are
perpendicular lines.
If the slope of Line
A is 4/5, what is
the slope of Line B?

Answers

Answer:

C

Step-by-step explanation:

Given a line with slope m then the slope of a line perpendicular to it is

[tex]m_{perpendicular}[/tex] = - [tex]\frac{1}{m}[/tex] = - [tex]\frac{1}{\frac{4}{5} }[/tex] = - [tex]\frac{5}{4}[/tex] ← slope of line B

The answer is

-5/4

this is dude to the slip being perpendicular which means that Line B will be the opposite reciprocal to Line A.

Line A=4/5
Line B=-5/4

Finding the volume of the sphere

Answers

Answer:

16

Step-by-step explanation:

correct me if im wrong

if iam right follow me heart this answer

carry on learning

yourhelpinghandishereforyou

Answer:

V≈2144.66058

Step-by-step explanation:

V=(4/3)(π)r^3

V=(4/3)(π)(8)^3

V≈2144.66058

Use the Pythagorean theorem to find the missing length in the right triangle

Answers

C^2 = a^2 + b^2

In this case your a is 24 and b is 7

That means c = sqaure root of(24^2 + 7^2)

C = 25

Answer:

Hi, there your answer is 25

Step-by-step explanation:

Here's the Pythagorean Theorem formula [tex]a^{2} +b^{2}=c^{2}[/tex]

[tex]7^{2}+24^{2}[/tex]=[tex]c^{2}[/tex]

49+576=[tex]c^{2}[/tex]

625=[tex]c^{2}[/tex]

[tex]\sqrt{625}=c^{2}[/tex]

[tex]25=c[/tex]

Hope this helps :)

Plzz help ill make u brainliest
Matt and Mindy each built a rectangular prism that has a length of 5 units, a width of 2 units, and a height of 4 units. Matt used cubes that are 1 cm on each side. Mindy used cubes that are 1 in on each side. What is the volume of each prism?

Answers

Answer:

Matt’s: 40 cm = 15.748 inches

Mindy’s: 40 in = 101.6 centimeters

Answer:

The volume is 40 cubed inches

Step-by-step explanation:

The prism that Matt built is 5 cm by 2 cm by 4 cm

5 ⋅ 2 ⋅ 4 = 40

The volume is 40 cubed centimeters

The prism that Mindy built is 5 in by 2 in by 4 in

5 ⋅ 2 ⋅ 4 = 40

The volume is 40 cubed inches

What is 2√54 + 5√24 in simplified radical form?
Enter your answer.

Please explain. :)

I really hope this question doesn’t get removed again or please tell me why it got removed.

Answers

Steps:

[tex]2\sqrt{5}\cdot \:4+5\sqrt{2}\cdot \:4[/tex]

[tex]\mathrm{Multiply\:the\:numbers:}\:2\cdot \:4=8[/tex]

[tex]=8\sqrt{5}+5\cdot \:4\sqrt{2}[/tex]

[tex]\mathrm{Multiply\:the\:numbers:}\:5\cdot \:4=20[/tex]

[tex]=8\sqrt{5}+20\sqrt{2}[/tex]

[tex]Answer = =8\sqrt{5}+20\sqrt{2}[/tex]

Answer:

21√6

Step-by-step explanation:

Here we are to combine 2√54 and 5√24, and want to find any factor that these two quantities may have in common.

2√54 can be factored:  2√54 = 2√9√6, or 2[√6√9], or 6√6

Similarly, 5√24 =5√6√9, or 15[√6]

These two results can and should be added together:  7*3√6 = 21√6

5) sabemos que numa fração decimal, o numerador (número acima do traço) é o decimal sem vírgula e o denominador (número abaixo do traço) é o algarismo 1 seguido de zeros. A quantidade de zeros é indicada pela quantidade de algarismos após 32/10 transforme na forma fracionária os números racionais representado na forma decimal. a)91,4 b)0,731 c)1,431 d)-21,2 e)8,13​

Answers

Answer:

pls ask question in English

You pick a card at random.
6 7 8 9
What is P(9)?
Write your answer as a fraction or whole number?

Answers

Answer:

1/4

Step-by-step explanation:

There are 4 cards

P(9) = number of 9's / total cards

      = 1/4

Assuming there are only four cards, and each card has the number from the list given, the value of P(9) is 1/4. This is because there is one card we want out of 4 total.

Answer:  1/4

You pick a card at random. Without putting the first card back, you pick a second card at
random.
5 6 7 8
9
What is the probability of picking a 5 and then picking a prime number?
Simplify your answer and write it as a fraction or whole number.

Answers

Answer:

5 prime to6

Step-by-step explanation:

pick all the nubers

Jessie borrowed $1800 from the bank at a rate of 7.5% simple interest per year. Over the course of 4 years, how much interest did he pay?

Answers

$540
Explanation:
7.5% of 1800 is 135
135 • 4 = 540

You and your family go out to dinner to build a total of $54 plan to leave 20% tip how much tip should you leave

Answers

Answer:

$10.8 is left.

Step-by-step explanation:

Given that,

Total amount = $54

Left amount = 20%

We need to find how much tip should you leave. It means we need to find 20% of 54. So,

[tex]A=\dfrac{20}{100}\times 54\\\\=\$10.8[/tex]

So, $10.8 is left.

Help plz..And No links!! I repeat No links!!

Answers

Answer:

From the Table...

Seems Dear Emma saw 4 plums.

She saw 4 Plums I believe.

first 5 terms in a number sequence

0.5 1 2 4 8

A) write down the term to term rule

b) 7th term of sequence

c) why cant 1527 be a term of the sequence

Answers

Answer:

Here we have the sequence:

0.5, 1, 2, 4, 8,...

A) we want to write the term to term rule.

We can see that each term is twice the one before, like:

2*0.5 = 1

2*1 =  2

2*2 = 4

2*4 = 8

etc.

So the term to term rule is just:

n-th term equals twice the previous term, or:

[tex]A_n = 2*A_{n-1}[/tex]

b) We can just construct the 7th term with the known ones:

We know that:

A₅ = 8

A₆ = 2*A₅ = 2*8 = 16

A₇ = 2*A₆ = 2*16 = 32

A₇ = 32

c) As each term in our sequence (unless for the first two ones) is a multiple of 2, we know that no odd number can be a term of this sequence.

1527 is an odd number, so this number can not be in the sequence.

The window of the school bus need to be washed by the end of the day. Mr.Casey washes 1/3 of the 33 before lunch. If Mr.Casey washes 8 of the remaining windows after lunch, how many windows still need to be washed by the end of the day? A 11 windows B 14 windows C 19 windows D 25 windows

Answers

Answer:

14 windows is the answer

Step-by-step explanation:

windows washed before lunch = 1/3 of total windows

= 1/3 * 33

= 11 windows

windows washed after lunch = 8

windows remaining = total - washed before lunch - washed after lunch

remaining = 33 - 11 - 8

= 33 - 19

= 14 windows

What is the volume of a triangular pyramid if the base area is 125 square feet and the height is 15 feet

Answers

Answer:

625 cubic feet

Step-by-step explanation:

Given data

Base area= 125 square feet

Height = 15feet

The expression for the volume of a pyramid is given as

V= a^2*h/3

but a^2= 125 square feet

V= 125*15/3

V= 1875/3

V=625 cubic feet

Put a check by all the prime numbers.

A)6

B)7

C)10

D)11

E)20

F)25

or none of the above

PICK HOW MANY U WANT JUST GIVE ME THE RIGHT ANSWER!

Answers

Answer:

7 and 11

Explanation:

Prime numbers are numbers that have only 2 factors; one and themselves.

Hope this helps!

Answer:

Only 7 and 11 are prime.

Step-by-step explanation:

prime numbers are numbers whose factors are only one and them selves

I also need help with this one

Answers

the right one is correct

Answer:

2nd option, it would look like the 2nd option

Step-by-step explanation:

Consider a figure in a coordinate plane. For each of the transformations below, first, transform the figure as stated. Then reverse the order of the sentences and transform the original figure a second time. Did the sequences result in the same image or a different image? Drag and drop each transformation in the cell with the appropriate heading

Answers

Answer:

no

Step-by-step explanation:

Show that the sum of the measures of the external angles of any polygon is 360°. [ HINT:- Draw three different polygons like a triangle, quadrilateral, pentagon. Extend each side, then measure the exterior angles from there. Finally, find the sum of measures of all exterior angles of each polygon.]

Answers

basically get a shape

eg we will work with triangles,, add angles to the inside,, ensuring they add up to 180 (because angles in a triangle add up to 180)

now that we have the angles,, extend each side with a line to show the exterior angles.

we know that angles on a line add up to 180,, so to find the external angle,, we can use our internal angle

you would use:

[ 180- internal angle]

do this for all external angles

add all your answers together,, should equal to 180

on square bcde if e is located at (4,-9) and d is located at (10,-5) find the perimeter of the square

Answers

Answer:

8[tex]\sqrt{13}[/tex] units

Step-by-step explanation:

We know that:

P = 4a

We can find one side by distance formula:

a = [tex]\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]a = [tex]\sqrt{(10 - 4)^2+(-5+9)^2} = \sqrt{36+16} = \sqrt{52} = 2\sqrt{13}[/tex]

Then the perimeter is:

P = 4*2[tex]\sqrt{13}[/tex] = 8[tex]\sqrt{13}[/tex] units

Helppppppppppppppppppppppppppppp!!!!!!!!!

Answers

Answer:

1. Yes

2.i don't know sorry

3. no

4. no

Step-by-step explanation:

1. it is a terminating decimal

2. I don't know sorry

3.it is a repeating decimal

4.itis a repeating decimal

Type the correct answer in each box. Use numerals instead of words. If necessary, use/for the fraction bar. Consider the given table.

Answers

Answer:

The ? represents the number 38 because the average rate of change on every interval of the function is 3

Step-by-step explanation:

Firstly, we calculate the average rate of change over a function can be calculated using the formula below;

f(b) -f(a)/(b-a)

Now, over the interval [-2,2]

we have;

(17-5)/(2/(-2)) = 12/4 = 3

This is expected to be the blanket average rate of change

Thus, we have it that over the interval [5,9]; we have;

3 = f(b) - 26/9-5

3 = f(b) - 26/4

4(3) = f(b) - 26

12 = f(b) - 26

f(b) = 12 + 26

f(b) = 38

Need help with this math urgently

Answers

Answer:

(2,5)

Step-by-step explanation:

y= 4x-3

y=-2x+9

-------------------------

 4x-3=-2x+9

6x-3=9

6x=12

x=2

-----------------

y = 4(2)-3

y =8 -3

y=5

(2,5)

Answer:

1st box: 6x - 3 = 9

2nd box: 6x = 12

3rd box: x = 2

4th box: y = 4(2) - 3

5th box: y = 8 - 3

6th box: y = 5

Step-by-step explanation:

Part A-

1) 4x-3 = -2x+9

2) 4x+2x -3 = -2x+2x + 9

3) 6x -3 = 9

4) 6x -3+3 = 9+3

5) 6x = 12

6) 6x/6 = 12/6

7) x = 2

Part B-

1) y=4x-3

2) y=4(2)-3

3) y=8-3

4) y= 5

Therefore, x = 2 and y = 5.

Uh, I think I did this one… good luck ;p

Please help

Calculate the volume of the given figure. Use 3.14 for ™.

3 ft

The volume of the solid figure shown in the drawing is approximately (Round to two decimal places as needed.)

Answers

Answer:

Step-by-step explanation:

Vol of a cylinder = pi * r^2 h

Vol of cone = 1/3 pi r^2 h

cylinder = pi *  (1)^2 * (3) = 3 pi

cone = 1/3 pi (1^2) 4 = 4/3 pi

total =   3 pi +  4/3 pi

        = pi(3+ 4/3) = pi(4.333)

= 13.6 f^3

Other Questions
HelpHelpHelpHelpHelpHelp Write two simple sentences about education a/ one sentence using one subject and two verbs b/ one sentence using two subjects and two verbs Peter work three more days than jill. Peter earn $20 day jill earn $40 day. But they earned the same amount of money Which of the following is an equivalent trig ratio for tan 28Cos 621/ tan 621/ tan152Cos 28 The answer choices are spelling rules about what to do before adding suffixes to a base word that ends in a consonant. Identify the rule that was applied to the word below.benefit + -ingDo not double the final consonant if the suffix begins with a consonant.If a base word has three or more syllables, do not double the final consonant.If a base word ending in one consonant has two syllables, and the second syllable gets the accent, double the final consonant.If a base word ends in more than one consonant, just add the suffix without changes.If a base word has only one syllable and ends in one consonant, double the final consonant.If a base word ending in one consonant has two syllables, and the first syllable gets the accent, do not double the final consonant. two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?A whether the producers are located on land or in waterB whether or not the food web includes tertiary consumersC whether the web includes animals that migrate during the yearD whether the ecosystem described by the web is localized or very broad two particles woth each charge magnitude 2.010^-7 c but opposite signs are held 15cm apart.what are the magnitude and direction of the electric field E at tge point midway between charges Subordinate Conjunctions make a _______ clause not be able to stand on its own. PLEASE HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP please help please help the tRNA for GUCAUCGAUCGAUCGGAUGCC A red light flashes every 6 seconds A yellow light flashes every 4 seconds They both flash at the same time.After how many seconds will they next both flash at the same time? The radius of a right circular cone is increasing at a rate of 1.1 in/s while its height is decreasing at a rate of 2.6 in/s. At what rate is the volume of the cone changing when the radius is 107 in. and the height is 151 in. The elements in a long array of integers are roughly sorted in decreasing order. No more than 5 percent of the elements are out of order. Which of the following is the best method to use to sort the array in descending order?I. Insertion sort.Il. Merge Sort.III. Heap Sort.a. Ill only.b. I only.c. II and III only.d. I and II only.e. Il only I and.f. Ill only. Help please I asp !!! For A = R + PRT/100 make P the subject. 1. What are metabolic wastes?2. Which are the main organs of the excretory system? please help me with this The practice of selling indulgences troubled many Catholics because the practice made it seem like? Which sentence in the paragraph is structured differently than the others? Which territory did the Mongol Empire conqueror after Genghis Khan's death