Which type of data is BEST described by a continuous model?
A)
pets owned
B)
height of boys
C)
girls in school
D)
crimes reported
It's b

Answers

Answer 1

Answer: b

step-by-step explanation:


Related Questions

can someone please help me? I'm really confused and I don't know how to do this.

Answers

Answer:

B

Step-by-step explanation:

Because they took the correct steps to answer the equation.They also got the right answer (-2).

At the begining they added 4 to both sides (to cancel out the 4)

C would be wrong because they subtracted 4 from a negative four and this does NOT cancel it out.

Have a Supercalifragilisticexpialidocious day, I hope you like my explination. If you do please give rating or brainliest :)

PLZ ANSWERE QUICKLY​

Answers

Transition because it mirrored but not exactly

In 1908, W.S. Gossett performed a sleep study on 10 subjects, comparing the number of hours of sleep obtained by each subject with and without (in that order) the application of the drug hyoscyamine. The paired differences d were as follows: 1.0, 0.8, 1.1, 0.1, - 0.1, 4.4, 1.5, 1.6, 4.6, 3.4 At the 1% significance level, is the drug effective in increasing sleep

Answers

Answer:

Since the calculated value of t= 2.8782 does not fall in the critical region so we accept H0 and may conclude that  the drug is not effective in increasing sleep.

Step-by-step explanation:

d              d²

1.0,          1

0.8,         0.64

1.1,           1.21

0.1,          0.01

- 0.1,       0.01

4.4,        19.36

1.5,          2.25

1.6,          2.56

4.6,         21.16

3.4          11.56

∑18.4      ∑59.76

1: We state our null hypothesis  as

H0 : μd= 0     against the claim Ha: μd ≠ 0  

2: The significance level is set at ∝  = 0.01

3: The test statistic under H0 is

        t= d`/ sd /√n

4:The critical region is t ≥ t ( 0.005) 9 = 3.250

5:Computation:

d`= ∑d/n= 18.4/10= 1.84

Sd² = ∑(di- d`)²/n-1 = 1/n-1 [∑di²- (∑di)² /n]

       = 1/9 [59.76 - (18.4)²/10]

        =(59.76 - 33.856)/9

          = 25.904/9

          = 2.8782

6: Conclusion:

Since the calculated value of t= 2.8782 does not fall in the critical region so we accept H0 and may conclude that  the drug is not effective in increasing sleep.

This is because we have taken H0 as the mean of the difference is zero.

This can only be zero when the drug is not effective.

If there are There are 914.4914.4914, point, 4 millimeters in a yard. There are 333 feet in a yard.
How many millimeters are in a foot?

Answers

Answer: 304.8

Step-by-step explanation:

for an approximate result, multiply the length value by 305

Answer: 304.8

Step-by-step explanation:

What is the unit rate of a line that goes through the points (3,1)?

Answers

Answer:

3.

Step-by-step explanation:

3 divided by 1 equals 3.

Please mark me brainliest I need it!!!

Help! Is the following relation a function?

Yes or no?

Answers

Answer:

no it is not a fuction

Step-by-step explanation:

A garden table and a bench cost $ 1045 combined. The garden table costs $95 more than the bench. What is the cost of the bench?

Answers

Answer:

Nvm misread question

Step-by-step explanation:

one second please

help me pls .................

Answers

Answer:

b

Step-by-step explanation:

I believe D but I might be wrong

Lauren broght cupcakes for class of 24 students including herself. Each person received 1 cupcakes. Cupcakes come in pack of 7

Answers

Answer:

4 Packs

Step-by-step explanation: 24 put into groups of 7: there will be 3 full groups (three groups of seven) and one group will have only three in it. Therefore, 4 packs will be emptied. Hope this helps you !

A random sample is to be selected from a population that has a proportion of successes p=.60. When n=400, what is the probability that a sample proportion falls between .59 and .62? Round your answer to three decimal places.

Answers

Answer:

0.45134

Step-by-step explanation:

Given that :

p = 0.6

n = 400

Probability that sample. Proportion falls between 0.59 and 0.62

Using Normal approximation :

Mean (m) = n * p = 400 * 0.6 = 240

Standard deviation (s) = sqrt(pq/n)

q = 1 - p = 1 - 0.6 = 0.4

s = sqrt((0.6 * 0.4) / 400) = 0.0244948

P(0.59 < p < 0.62) :

(x - m) / s

P((0.59 - 0.6) / 0.0244948) < p < P((0.62 - 0.6) / 0.0244948)

P(Z < −0.408249) < p < P(Z < 0.8164998)

Using the Z probability calculator :

0.79289 - 0.34155 = 0.45134

is Obama black

sry I'm blind cant tell

Answers

Answer:

Yes

Step-by-step explanation:

Answer:

Yes he is

Step-by-step explanation:

If m is a multiple of 20 then m is also a multiple of 10 true or false​

Answers

True .... I think?? Cuz if m=40 (cuz 40 is a multiple of 20) and 40 is also a multiple of 10

Jill lives miles away from her school, and Ben lives miles away from his school. Which statement is true?
A.
Ben travels farther than Jill to school.
B.
Jill travels farther than Ben to school.
C.
Ben and Jill travel exactly the same distance to school.
D.
Ben and Jill travel approximately the same distance to school.

Answers

Answer:

Ben and Jill travel exactly the same distance to the school

They travel exactly the same distance

Describe two ways you can find the measure of <7.

Answers

Answer:

angle 7= 66

Step-by-step explanation:

Angle 1 is equal to the 114 degrees. And angle 1 + angle 7 = 180. So it would be 114 + angle 7 = 180. So you do 180-114 = 66. So angle 7= 66.

The other way is that 114 + angle 6 = 180, so you do 180-114= 66.

And agle 6 is equal to angle 7, so that's another way you can know that angle 7= 66

Identify the pattern rule for this sequence

Answers

Answer:

what sequence bruv

Step-by-step explanation:

theres nofin there

Answer:

ertg4b4tgedx3sfqawe ctxdsfawectdfsqeretcxf

Step-by-step explanation:

rt4wqcxdewqcrxfxdfewccrxweccsfcdsxdcrcwe

Last Sunday the average temperature was 8% higher than the average temperature Sundays ago. The average temperature two Sundays ago was t degrees Celsius chose the answer

Answers

Answer:

1.08.

Step-by-step explanation:

After 100 spins, Lincoln calculated the probability that he would spin a prime number to be 0.35. Using the
spinner, what is the theoretical probability of spinning a prime number?
An 15

Answers

Given:

Total number of spins = 100

Probability that he would spin a prime number to be 0.35.

To find:

The theoretical probability of spinning a prime number.

Solution:

Total numbers from 1 to 100 = 100

Total prime numbers from 1 to 100 are 2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47, 53, 59, 61, 67, 71, 73, 79, 83, 89, 97.

So, the prime numbers from 1 to 100 = 25

Now, the probability of spinning a prime number is

[tex]\text{probability}=\dfrac{\text{Total prime numbers from 1 to 100}}{\text{Total numbers from 1 to 100}}[/tex]

[tex]\text{probability}=\dfrac{25}{100}[/tex]

[tex]\text{probability}=0.25[/tex]

Therefore, the theoretical probability of spinning a prime number is 0.25.

It takes Jada 20 minutes to walk to school. It takes Andre 80% as long to walk to school. How long does it take Andre to walk to school?

Answers

Answer:

16 minutes

Step-by-step explanation:

If it takes Jada 20 minutes and it takes Andre 80% as long, then you multiply 20 by %80

20 * .80 = 16 minutes

Answer:

It takes Andre 16 minutes

Step-by-step explanation:

I know this because 80% of 20 is 16 minutes

I need help with math homework

Answers

Answer:

A. (1, 2) and (4, 3)

B. Slope (m) = ⅓

C. y - 2 = ⅓(x - 1)

D.[tex] y = \frac{1}{3}x + \frac{5}{3} [/tex]

E. [tex] -\frac{1}{3}x + y = \frac{5}{3} [/tex]

Step-by-step explanation:

A. Two points on the line from the graph are: (1, 2) and (4, 3)

B. The slope can be calculated using two points, (1, 2) and (4, 3):

[tex] slope (m) = \frac{y_2 - y_1}{x_2 - x_1} = \frac{3 - 2}{4 - 1} = \frac{1}{3} [/tex]

Slope (m) = ⅓

C. Equation in point-slope form is represented as y - b = m(x - a). Where,

(a, b) = any point on the graph.

m = slope.

Substitute (a, b) = (1, 2), and m = ⅓ into the point-slope equation, y - b = m(x - a).

Thus:

y - 2 = ⅓(x - 1)

D. Equation in slope-intercept form, can be written as y = mx + b.

Thus, using the equation in (C), rewrite to get the equation in slope-intercept form.

y - 2 = ⅓(x - 1)

3(y - 2) = x - 1

3y - 6 = x - 1

3y = x - 1 + 6

3y = x + 5

[tex] y = \frac{1}{3}x + \frac{5}{3} [/tex]

E. Convert the equation in (D) to standard form:

[tex] y = \frac{1}{3}x + \frac{5}{3} [/tex]

[tex] -\frac{1}{3}x + y = \frac{5}{3} [/tex]

If Susan can type 84 words in 4 minutes, is she faster or slower than 28 words per minute? !!PLEASE ANSWER!!

Answers

Answer:

Yes

Step-by-step explanation:

84/4=21/1 vs 28/1

Answer:

Slower

Step-by-step explanation:

If you divide 84/4, you get 21. This is the amount that she types per minute. 21 words per minute is less than 28.

10. Do these figures have the same or the opposite orientation?

Answers

Answer:

Opposite

Step-by-step explanation:

The given figure has the same orientation.

Figures are shown, Do these figures have the same or the opposite orientation is to be determined.

What is orientation?

the action or process of orienting or the circumstances of existing oriented. placement or position in relation to the points of the compass or other precise directions. the adjustment or alignment of oneself.

As per definition, let's assume the point at mid of H and mid of o when joined that point a line will form on both the hello, across that line thing between two images is same that why these two images have the same orientation. Each point on both the images has a fixed distance and angle to the imaginary line formed(we assumed).

Thus, the given figure has the same orientation.

Get more information about orientation here:
https://brainly.com/question/12049504
#SPJ5

$80 jacket: 15% off: 5.5% tax

Answers

Answer:68.055

Step-by-step explanation:Google said so ;))

Find the diagonal of the box using the Pythagorean Theorem.
PLS HELP ASAP 50 POINTS PLEASE HELP ASAP PLEASEEE!!!! I NEED HELP ASAP
(Image Linked)

Answers

Answer:

26 cm

Step-by-step explanation:

Diagonal of the box using Pythagorean Theorem can be calculated using the formula:

a² + b² + c² = d²

Where,

d = diagonal of the box = ??

a = length = 24 cm

b = width = 8 cm

c = height = 6 cm

Plug in the value into the formula

24² + 8² + 6² = d²

576 + 64 + 36 = d²

676 = d²

√676 = d

d = 26 cm

Solve the proportion x/8= 3/12. Please help.

Answers

Answer:

2

Step-by-step explanation:

[tex] \frac{x}{8} = \frac{3}{12} \\ \\ x = \frac{8 \times 3}{12} \\ \\ x = \frac{24}{12}\\ \\ x = 2[/tex]

A stadium has direct staffing costs of $108,000. Overhead costs (social security, medicare, worker's compensation, etc.) cost the stadium an additional 15%. What is the total staffing cost?

Answers

9514 1404 393

Answer:

  $124,200

Step-by-step explanation:

We have ...

  staffing cost = (direct cost) + 0.15·(direct cost)

  staffing cost = (direct cost) · 1.15 = ($108,000)(1.15)

  staffing cost = $124,200

simplify the equation

Answers

Answer:

The answer is C

Step-by-step explanation:

I say this because you have to simplify and  plug in the numbers to get answer choice c

Harold filled his swimming pool over the weekend. The pool has a capacity of 540 gallons. Harold put in 180 gallons of water on Saturday. The garden hose that Harold used supplies 9 gallons of water per minute. How long did it take for Harold to fill the pool to capacity on​ Sunday? Define a variable for the unknown quantity. Write and solve an equation to answer the question.

Let m= the number of _________
a.) gallons in the pool on Sunday
b.) Minutes to fill the pool on Saturday
c.) gallons the garden hose puts in the pool on Sunday
d.) minutes to fill the pool on Sunday

An equation to represent the situation is __________=540.
a.) m+89
b.) 189m
c.) 9m+180
d.) 180m+9

So, m= _________. It took Harold ____________ minutes to fill the pool to capacity on Sunday.

Answers

Answer:

b

c

40

Step-by-step explanation:

I have already had this question before.

simplify the fraction 9/18

Answers

1/2 :) dksjsjdndkskskdndn

9/18

Divide by 9

9/9=1

18/9=2

Answer : 1/2

PLEASE HELP ME !!!
:(

Answers

Answer:

Step-by-step explanation:

G is the incenter of ΔABC,

Incenter of a triangle is defined by the point where angle bisectors of the interior angles intersect.

10). m∠ABG = m∠CBG = 25°

11). m∠BCG = m∠ACG = 18°

  Therefore, m∠BCA = m∠BCG + m∠ACG = 2×18° = 36°

12). m∠ABC + m∠BAC + m∠ACB = 180°

  2(25)° + m∠BAC + 36° = 180°

    m∠BAC = 180° - 86° = 94°

13). m∠BAG = [tex]\frac{1}{2}[/tex](m∠BAC) = 47°

14). Since, incenter is equidistant from all sides of the triangle,

     Therefore, DG = GF = FE = 4 units

15). In right triangle BEG,

     tan(25)° = [tex]\frac{\text{GE}}{\text{BE}}[/tex]

     BE = [tex]\frac{\text{GE}}{\text{tan}25}[/tex]

           = [tex]\frac{4}{\text{tan}25}[/tex]

     BE = 8.6

16). In right triangle BEG,

     cos(25)° = [tex]\frac{\text{4}}{\text{BG}}[/tex]

     BG = [tex]\frac{4}{\text{cos}25}[/tex] = 4.4

17). In right triangle GEC,

    sin(18)° = [tex]\frac{\text{GE}}{\text{GC}}[/tex]

    GC =  [tex]\frac{\text{4}}{\text{sin}(18)}[/tex] = 12.9

What is the slope of the line that passes through the given points?
(-12,-4) and (11,-10)

Answers

Answer:

Y2-y1

X2-×1 = m

-12-(-10)

11-5     = -2/3

m= -2/3

Step-by-step explanation:

Other Questions
A certain relationship is defined as having only one corresponding y-value for each x-value. Which of the following best describes this relationship? A. variable B. expression C. function D. equation 1. Use the following graph to determine the coordinated of the y-intercept.A. (5,0)B. (4,0)C. (0,4)D. (0,5)HURRY!!! Please. How does the theme that stories can help us understand oneanother develop in "The Speech"? 2 The density of a substance can be determinedby finding the unit rate that compares mass tovolume. A nugget of gold has a mass of463.2 grams and a volume of 24.0 milliliters.What is the density of gold?F 11,116.8 g/mLG 439.2 g/mLH 0.052 g/mLJ 19.3 g/mL Answer #1 and #2 for Brainliest! Plz answer if you know and not just for points Though Shaka was a great African leader he was unable to keep his kingdom intact against the superiorweapons of the British. The Zulus became part of British controlled land in 1887. Many of the whiteImperialists believed it was their duty to then convert natives to western cultural values. The discovery ofdiamonds and gold in southern Africa created a world rush to exploit fortunes from these products for thecolonizers. The legacy of this time period is complex. The mixing of cultures has led to new culturalgroups such as peoples in Mexico with indian and Spanish blood. Colonization also led to the rise of manyruthless military leaders who had little experience with democracy or human rights leaving many colonizedareas struggling in the modern age.Select the best word because the paragraph mentions African leaderAssimilationNatural rights/EnlightenmentEconomicsPolitics/ExecutiveNatural ResourcesConquistadors/Absolute powerWhite Man's BurdenIndirect ruleBud A medium pizza at Benny's Pizza costs $13.60 plus $2.50 for each topping. At Ricco'sPizza, a medium pizza costs $14.60 plus $2 for each topping. For how many toppingswill the pizzas cost the same price?O 2 toppingsO They will always cost the same. 1 toppingO They will never cost the same. Please help! 20 points and brainly!!Which ratio forms a proportion with 14/42? 1/4 7/21 12/40 28/80(Please explain how you got the answer) What are all the secrets to the universe ? 25. Which of these does natural selection work on?a. Only animalsb. All populationsc. Only microscopic organismd. Individualse. Only small The graph of a system of equations will intersect at exactly 1 point? PLZ HELP! DUE TODAY! I WILL GIVE BRAINLIEST TO FIRST ANSWER THAT IS CORRECT!The parts of a personal letter are similar to a business letter but slightly different in form. True False Angle J and angle K are complementary angles. The measure of angle J is 18 less than the measure of angle K. Fine the measure of both angles.Please and thank you. Describe the pattern in the following sequence and list the next three terms:4,8, 16, 32, ... I need help with this ASAP ..... It is over due and I have to get it done and show work .. Please and thank you who is your favorite character from Gorillaz and why?? :) what are Sources of thermal pollution Solo Corp. is evaluating a project with the following cash flows: Year Cash Flow 0 $28100 1 10,300 2 13,000 3 14,900 4 12,000 5 8,500 The company uses an Interest rate of 8 percent on all of Its projects. a. Calculate the MIRR of the project using the discounting approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places. e.g., 32.16.) b. Calculate the MIRR of the project using the reinvestment approach. (Do not round Intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) c. Calculate the MIRR of the project using the combination approach. (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.) a. Discounting approach MIRR % b. Reinvestment approach MIRR % c. Combination approach MIRR Y. Find the quotient: 6)27L 600 mL Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT